... Центральный узел Системы ДО МГУ. ... Применение SCORM 2004 Content Aggregation Model при создании базы данных системы дистанционного обучения ФДО МГУ. Информационная среда дистанционного обучения (ИСДО) ФДО МГУ предназначена для обеспечения коммуникационной и информационной поддержки процесса дистанционного обучения . ... В настоящее время предложено несколько стандартов электронного дистанционного образования. В настоящее время база данных ИСДО ФДО МГУ содержит более 100 таблиц . ...
... Faculty of Soil Science, Moscow State University . ... Evaluation of acid deposition effects on soils as a component of forest ecosystems. ... Estimation and prediction of forest soil response to acid deposition with simple process-based models. ... Forest soil response to acid deposition, in particular the significance of soil organic matter in the processes of proton consumption, sulphur retention, aluminium and heavy metals mobilisation was investigated. ... Acid Deposition and Forest Soils. ...
... Many of these planetesimals had metallic iron cores and during growth of the Earth this metal re-equilibrated with the Earth's silicate mantle, extracting siderophile (`iron-loving') elements into the Earth's iron-rich core. ... Chemical signature of core formation Growth of the Earth from planetary embryos and planetesimals resulted in the substantial partitioning of siderophile elements into the metallic core, leaving lithophile elements behind in the silicate mantle. ... REE, rare-earth elements....
[
Текст
]
Ссылки http://ocean.phys.msu.ru/courses/geo/lectures-addons/02/2006%20Wood%20et%20al.%2C%20Accretion%20of%20the%20Earth%20and%20segregation%20of%20its%20core.pdf -- 767.0 Кб -- 28.08.2009 Похожие документы
... 000, 113 (2010) Printed 21 September 2011 A (MN L TEX style file v2.2) A universal ultraviolet-optical colourcolourmagnitude relation of galaxies I1gor V. Chilingarian1,2, and Ivan Yu. ... Received 2011 Sep 15; in original form 2011 Feb 6 ABSTRACT The bimodal galaxy distribution in the optical colourmagnitude diagram (CMD) comprises a narrow "red sequence" populated mostly by early-type galaxies and a broad "blue cloud" dominated by star-forming systems. ...
Страница поддержки курса "Алгоритмы и алгоритмические языки" для 1 потока . ... Older posts . Posted on 15.01.2016 by abel . ... Второй коллоквиум по курсу состоится в субботу 05 декабря на первой паре. ... В секции рекомендуемой литературы обновлены ссылки на электронные версии методических пособий:љ 1) по языку Си и алгоритмам, 2) по экзаменационным задачам прошедших лет. ... Лекции по АиАЯ для первого потока будут проходить по средам и субботам в аудитории П6 на первой паре. ... Курс АиАЯ . ...
The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...
... site navigation | footer (site information) . IChO-2007 Participation Problems IChO RUSSIA Sponsors search . ... Moscow-1996 | ... Chemistry Department | ... Homepages of National Competitions Other International Science Olympiads Previous IChO's Miscellaneous Chemistry sites . ... Some fresh information is available. A letter from the President of 39th IChO . ... Information about post-Olympiad tour is now available . ... Information about guides of 39th IChO is now available. ...
Human longevity at the cost of reproductive success: evidence from global data ц б F . ... Abstract A trade-off between reproduction and somatic maintenance and hence survival is fundamental to life-history theory. We investigated the relationship between female fecundity and longevity in Homo sapiens using data from 153 countries located all over the world. The raw correlation between life span and fecundity was highly signi®cant with a negative trend. ... 1998; Polis et al., ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2000_Longev_JEvolBio.pdf -- 97.8 Кб -- 16.03.2009 Похожие документы
Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...
... The optimal control, which led oscillatory system to a certain energy level from any initial conditions at minimum time, is found. ... A set of points where the trajectory becomes an arc of a circle with the other center is called the switching line. ... For drawing switching line near the origin (see for example Figure 3) we note from the system (1) that time is proportional to the sum of the angles 214 this sums for optimal and quasi-optimal processes. ... The control function (14) is not optimal....
... Place: A private EE centre (Laboratory for Optimization of Nature Exploitation LONE) and public kindergartens at Pushchino in the Moscow region. Target groups: Pre-school age children (3-6), school children (9-15), kindergarten teachers. ... In the second phase training was provided to all kindergarten teachers who volunteered to participate in the project as well as for 20 school children selected during practical courses, lectures and seminars. ...
Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...
Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
... Authors: T. Bohm et al. arxiv:1411.7032 19-мегапарсековое расстояние до сверхмассивной черной дыры в NGC 4151, определенное по "пылевому параллаксу" (A dust-parallax distance of 19 megaparsecs to the supermassive black hole in NGC 4151) . ... Authors: Patrick L. Kelly et al. arxiv:1411.4666 KOI-1299: красный гигант, взаимодействующий с одной из двух долгопериодических гигантских планет (KOI-1299: a red giant interacting with one of its two long period giant planets) . ... Authors: John Southworth . ...
Home Search Collections Journals About Contact us My IOPscience On the problem of the spontaneous exchange-driven electron interwell re-population in semiconductor quantum wells This article has been downloaded from IOPscience. ... The wave function for an electron in the second well has a similar form. ... Now our goal is to prove that for any electron state with all electrons in one well one can build another state with electrons equally populating both wells, which is lower in energy. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...