... Medium (solvent) coordinates 3. Quantum effect of solvent on activation barrier 4. ... sucrose solutions: C D ( w) = + + 1 + (iw C ) 1 + iw water-EG mixtures: D 3 1 2 ( ) = + + + 1 + i 2 1 1 + i 2 2 1 + i 2 3 series N solvent modes Solvent reorganization energy (exact expansion ) correlation times K ( ) = 2k BT Solvent correlation function i =1 N i exp (- / ) * i i =1 N i = 1 i is the contribution of i-th mode to the solvent reorganization energy The solvent reorganization ...
... Начало www.99ru.ru Образование и наука Программирование Компьютеры 1997 . ... Искусство . История.Философия . ... Художественные . ... Первые и прижизненные издания . ... История Всемирная . ... Этнография Фольклор . ... Наследие Востока . ... Введите код товара из каталога. автор Access . ... 1997 . ... Настоящее практическое пособие посвящено изучению Microsoft Access 97. ... Владение Microsoft Access 97 в объеме данного издания входит в программу сертификации пользователей Microsoft Office . ...
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
The Future of GPU Computing Wen-mei Hwu University of Illinois, Urbana-Champaign Agenda · · · · Setting the Context Current Victories Coming Battles Conclusion and Outlook NVIDIA HPC Day Moscow State University 2012 CPUs: Latency Oriented Design · Large caches Convert long latency memory accesses to short latency cache accesses ALU Control ALU ALU · Sophisticated control Branch prediction for reduced branch latency ... NVIDIA HPC Day Moscow State University 2012 ...
[
Текст
]
Ссылки http://ccoe.msu.ru/sites/default/files/presentations/Moscow-Keynote-Hwu-10-22-2012.pdf -- 1614.3 Кб -- 25.10.2012 Похожие документы
... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...
... Electronic journal Issue 4. 10 september 2004 Paliulis N., Chlivickas E. E-government as a Challenge of Public Management Development Introduction. ... This also includes the transfer of various data from hardcopies (documents) to digital media (databases), provision of information and services to citizens and businesses via electronic means (websites, e-mails, etc.) ... The main obstacle for the development of electronic public services is the small number of Internet users in Lithuania. ...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./paliulis_chlivickas.pdf -- 226.2 Кб -- 06.07.2014 Похожие документы
To use Microsoft Outlook Web access, browser settings must allow scripts to run. ... If your browser does not support scripts, you can download Microsoft Internet Explorer for access to Outlook Web Access. ... Select this option if you use Outlook Web Access on a public computer. ... This is a private computer . ... Use Outlook Web Access Light . ... Type the address for Outlook Web Access into the field, click Allow, and then click OK to save your changes. Connected to Microsoft Exchange . ...
... Course Name . ... Software Development for Computational Problems . ... Prof. Fedor S. Zaitsev . Data Analysis Methods . ... Computational Physics and Nanotechnology . ... Assoc. Prof. Igor N. Inovenkov . Mathematical Models for Dynamic Processes . ... Prof. Igor V. Zotov . ... One-Dimensional Problems of Mathematical Physics . ... Two-Dimensional Problems of Mathematical Physics . ... Maple for Mathematical Physics Problems . ... Source URL: http://ani.cs.msu.su/en/courses . ...
... The technique had been developed for calculating destruction of melting vitreous bodies in hypersonic gas flows taking into account the internal radiative transfer. ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...
Lessons learned from the Thirty Meter Telescope site testing Tony Travouillon Sebastian Els, Angel Otarola, Reed Riddle, Matthias Schoeck, Warren Skidmore TMT.XXX.PRE.05.0XX.DRF01 1 Introduction TMT and its Site testing. Important choice before going on site. ... Considerations during analysis of the data. TMT.XXX.PRE.05.0XX.DRF01 2 Some Background about the TMT Site Testing TMT is a 30m, segmented, RitcheyChretien telescope design. ... ASCA Cloud Cover Analysis So how do we do it in practice? ...
[
Текст
]
Ссылки http://site2010.sai.msu.ru/static/doc/TTravouillon_TMT_site_testing_site2010.pdf -- 2354.3 Кб -- 18.10.2010 Похожие документы
МГУ имени М.В.Ломоносова Русская версия . ... Section ?Psychology? ... 29 Feb 2016 . ... 15 Apr 2016 . ... Chair Yury P. Zinchenko, professor, Dean of the Faculty of Psychology MSU . ... Chair Yury P. Zinchenko, Dean of the Faculty of Psychology MSU, academician RAE . ... A.G.Asmolov chair of the department of Personal Psychology, academician RAE; . ... B.S.Bratus chair of the department of General Psychology, corresponding member RAE; . ... Actual problems of sport psychology and healthy lifestyle. ...
... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...
Lomonosov Moscow State University was established in 1755 . ... Lomonosov Moscow State University Diary . ... MSU Web Sites . ... General Information . ... Study and Research . ... MSU Online . ... Research Priorities in Sciences at MSU: . ... MSU-RAS Research Institute of Soil Science . ... Research Priorities in Humanities at MSU: . ... Research Priorities in Social Sciences at MSU: . ... Research Priorities in the Humanities at MSU: . ... Research Priorities in Sciences and Humanities at MSU: . ...
. Sites . Remove access privilege . You can remove yourself from the Owner, Collaborator, or Viewer list from this site by clicking the "Remove Access" button. Once access is removed it can not be undone by yourself. Remove access . Cancel
... Formulation of the problem angle about the mass center C IC = mR 2 central moment of inertia m and R mass and radius of the hula-hoop k coefficient of viscous friction r radius of the waist FT friction force N reaction force angle between x and CO x = a sin t , IC m m Ё +k (R - (R - y = b cos t = -FT R r ) = m (x sin + y cos ) + FT Ё Ё Ё r ) 2 = m (x cos - y sin ) + N Ё Ё (R - r ) = R non-slippage where constants 0 mod 2 are defined from + µ cos 0 = 0. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
1990k: 70007 70E99 (58F40, 76D25) Samsonov V.A., Shamolin M.V. On the problem of the motion of a body in a resisting medium (Russian). ... 70: Mechanics of particles and systems. 70E: Dynamics of rigid body. ... 58F: Ordinary differential equations on manifolds; dynamical systems. ... Russian. ... 34: Ordinary differential equations. ... As applications we consider dynamical systems that describe the plane-parallel motion of a body in a resisting medium as well as various model variants of it." ...