Nuclear Instruments and Methods in Physics Research B 150 (1999) 622±627 Roman mosaic glass : a study of production processes, using PIXE spectrometry S.J . Fleming a, C.P . Swann a b b,* MASCA, University of Pennsylvania Museum, Philadelphia, PA 19104, USA Bartol Research Institute, University of Delaware, Newark, DE 19716, USA Abstract The most attractive Roman glass produced during the early part of the 1st century A.D.. was ... Roman mosaic glass During the reign of Augustus (27 B . ...

Еще в разделе: (Показать все результаты (>95) - hbar.phys.msu.ru/ )

• http://hbar.phys.msu.ru/gorm/fomenko/fomenko2.pdf
• http://hbar.phys.msu.ru/gorm/ahist/antikythera2.pdf
• newtrev2.htm

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...

Еще в разделе: (Показать все результаты (>5) - cell.biophys.msu.ru/ )

... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...

Еще в разделе: (Показать все результаты (>19) - hep.phys.msu.ru/ )

МГУ имени М.В.Ломоносова Русская версия . ... Chairman - Professor Dmitry G. Koshchug, Dean of Graduate School of Innovative Business . Vice-Chairman - Sergey Karev, Graduate School of Innovative Business, Associate Professor. ... Gvozdanny Vyacheslav Afanasievich - head of the Master Degree programm in Management at Graduate School of Innovative Business, Associate Professor; . ... Section "Innovative nature resource management" was organized in 2008 by the Graduate School of Innovative Business. ...

Еще в разделе: (Показать все результаты (>19) - conf.msu.ru/ )

... 2003 . ... Astrophysics of isolated neutron stars: radioquiet neutron stars and magnetars Sergei B. Popov; polar@sai.msu.ru; popov@pd.infn.it Sternberg Astronomical Institute, Moscow, Russia; University of Padova, Italy Mikhail E. Prokhorov; mike@sai.msu.ru Sternberg Astronomical Institute, Moscow, Russia Here we review present state of theoretical and observational exploration of isolated neutron stars. ... Gvaramadze, V.V.) 2002, «Neutron stars in supernova remnants and beyond», astro-ph/0212541...

Еще в разделе: (Показать все результаты (>15) - astrometric.sai.msu.ru/ )

• Symbolic circuit processor
• Symbolic matrix processor
• Scientific Literature

... Dear creators of the Bensons courses! First of all I would like to thank you for such a magnificent English course! ... Look, it's really much more interesting - to listen to a virtual book, to look through the pictures, let alone role-play! ... However, I'm very glad that I took up "Bensons" - the course has given me wonderful possibilities to learn more about English culture, to fill some gaps in my knowledge of English grammar and just to spend my time with great pleasure and benefit! ...

Еще в разделе: (Показать все результаты (>7) - anazarenko.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр Дистанционного обучения.

... Область ПЛИС-компьютеров является достаточно молодой и бурно развивающейся в настоящее время. ... CLB (Configurable Logic Blocks) - программируемый логический блок, часть FPGA-устройства, предназначенная для программирования некоторой функции или ее части. ... FPSC (Field Programmable System Chip) - устройство, представляющее собой объединение на одном кристалле FPGA и встроенного ASIC -ядра. ... PLA (Programmable Logic Array) - программируемые логические устройства наподобие ППЗУ . ...

Еще в разделе: (Показать все результаты (>8) - fpga.parallel.ru/ )

• Конференции по реконфигурируемым системам
• Технология устройств CPLD

Физический факультет МГУ . Главная . О кафедре . ... Заседание кафедры 15.10.15 . ... CrystEngComm, (2014). ... Лауреат Нобелевской премии по физике 1978 года. ... Лауреат Нобелевской премии по физике 1962 года. ... Кафедра физики низких температур и сверхпроводимости (ул. Академика Хохлова стр.8, Физический факультет, Ленинские горы д.1, ГСП-2, Москва 119991 Россия. +7 (495) 939-4811 . ... Физический факультет МГУ имени М.В. Ломоносова ї 2014 . ...

154. http://www.geol.msu.ru/obsh/uch_ch2.doc

155. staff:guterman:publ_engl.html | Кафедра высшей алгебры

156. http://master.cmc.msu.ru/files/computer_architecture.pdf