... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

: .. , . . , . - ( ) ( e-mail: kazakova.a.u.@yandex.ru) , , , , modern city, the slums, the marginalized, methodical and methodological problems , . : ; ; - , ; . This article is devoted to methodically important problem of the poll among few cathegories of marginal stratas, mainly to inhabitants of urban slums. Some thypical for underclass research problems are examining, namely: the data verification, the inhabitants accessibility, the communicative barriers and the slective methods.

Еще в разделе: (Показать все результаты (>90) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2011/1/09.pdf
• http://www.socio.msu.ru/vestnik/archive/2010/2/07.pdf
• http://www.socio.msu.ru/vestnik/archive/2010/3/20.pdf

. Developed by ValVe . Uses gnuplot v4

Еще в разделе: (Показать все результаты (>3) - depni.sinp.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>2) - prac-gw.sinp.msu.ru/ )

I. S. MAMAEV Institute of computer science 426034, Russia, Izhevsk Universitetskaya St., 1 E-mail: mamaev@rcd.ru NEW CASES WHEN THE INVARIANT MEASURE AND FIRST INTEGRALS EXIST IN THE PROBLEM OF A BODY ROLLING ON A SURFACE Received September 16, 2003 DOI: 10.1070/RD2003v008n03ABEH000249 Some new cases when the invariant measure and an additional first integral exist in the problem of a rigid body rolling on a sphere and on an ellipsoid are discussed in the paper. ... Rolling of a ball on a surface. ...

Еще в разделе: (Показать все результаты (>138) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/ca2/173-hamiltonicity-and-integrability-of-the-suslov-problem_ru.pdf
• http://ics.org.ru/upload/iblock/ecf/PHDK32.pdf
• http://ics.org.ru/upload/iblock/daa/139-notes-on-diffusion-in-collisionless-medium_ru.pdf

The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...

Еще в разделе: (Показать все результаты (>5) - www.rlcentre.com/ )

... Conference Schedule . ... Visa Support NEW! ... Registration . For registration at the 14th International Meeting of the International Humic Substances Society (IHSS) please download the Registration Form , fill it in, and send to the Conference Secretariat by e-mail ihss@org.chem.msu.ru . ... Registration Fee and/or Accommodation and/or Social Fee for Participation at the IHSS-14 Conference from " Full NAME of Participant(s) " . ... September 13, 2008, 9 a.m. - 9 p.m. - Arrival Day . ...

Еще в разделе: (Показать все результаты (>122) - mgumus.chem.msu.ru/ )

• List of participants

Evolution of the double neutron star merging rate and the cosmological origin of Gamma-ray burst sources " , Astroph.J., 1995, v.454, 593-596 (Lipunov, V.M. Postnov, K.A. and Prokhorov M.E.) . Evolution of SupernovaЃExplosion Rates in theЃ Universe (Jorgensen H., Lipunov.M., Panchenko I.E., Postnov K.A., Prokhorov M.E.) ApJ, 1997, v.486,p.110 . ... Formation of a Gravitationally Bound Object after Binary Neutron Star Merging and GRB phenomena " (G.V.Lipunova, V.M.Lipunov). ...

Еще в разделе: (Показать все результаты (>20) - observ.pereplet.ru/ )

• MASTER GLOBAL ROBOTIC TELESCOPES NET

Service . Analytical Laboratory Provides Service In The Field Of . Applied Statistics. Training in applied statistics and in statistical software tools usage. Formalization of practical problems and solution algorithms choosing. Applied statistical problems solving, using Your data. ... Consultations on choosing of Russian and American software tools for applied statistical problems. Phone/Fax: (095) 939-5306 . e-mail: makarov@makarov.msu.ru . ... Fax . ... InCo . ...

Еще в разделе: (Показать все результаты (>3) - statsoft.msu.ru/ )

Speech of the Head of the Federal Agency for Education Mr. G.A. Balykhin at the leading higher school institutions of Russia and China forum "The role of international cooperation in the Higher Education Quality Increase" Dear rectors of the leading Higher School Institutions of Russia and China! ... Dear rectors! ... As you know, the 1st Forum was held in Peking University, during the "Year of Russia in China". ... Best wishes, good luck, the 2nd Forum of Rectors of Russia and China! ...

Еще в разделе: (Показать все результаты (>33) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/12.doc
• http://www.rsr-online.ru/doc/norm/396.doc
• http://www.rsr-online.ru/doc/norm/328.doc

... Вакансии . ... Samsung Advanced Institute of Technology . ... Doctor of Philosophy (PhD) or Master of Science (MS) in Optoelectronic Device Technologies (Semiconductor Laser Science and Technology) . ... Development of optoelectronic device technologies and semiconductor laser science and technology . ... Work with researchers and engineers at SAIT and Samsung Electronics / Samsung Electro-Mechanics, its industrial partners, to transfer the developed technology to successful commercial products . ...

Еще в разделе: (Показать все результаты (>92) - www.physcareer.ru/ )

• Assistant Finance Manager / Вакансии / Physcareer.ru
• Multimedia Codec Developer in Mobile Handset / Вакансии / Physcareer.ru
• Android Platform Developer / Вакансии / Physcareer.ru

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

153. Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Наши

154. http://www.fbm.msu.ru/sci/conf/2013/mio/infletter-e.pdf

155. : Package ucar.multiarray

156. Psychology in Russia: State of the Art, Vol. 2, 2009

157. clothes and alternative things that perfectly express the spirit of classic and

158. http://www.elch.chem.msu.ru/rus/conf/vorotyntsev2013.pdf

159. http://www.phys.msu.ru/rus/about/structure/admin/OTDEL-FOREIGN/INVITATIONS/LUT_Summer_School_2013_staff.pdf