... Information on your customer account . ... Brazil British Indian Ocean Territory Brunei Darussalam Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote D'Ivoire Croatia Cuba Cyprus Czech Republic Denmark Djibouti Dominica Dominican Republic East Timor Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland...

Еще в разделе: (Показать все результаты (>46) - www.bukivedi.ru/ )

• www.99ru.ru -

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>8) - iconolat13.phys.msu.ru/ )

The Laboratory of the Historical Information Science . ... The historical information science laboratory was founded within the structure of the source studies department on 8 December 1995 for the purpose of fulfilling the decision of the academic council of the History Faculty of 4 October 1991 about the transformation of a group for the application of mathematic methods and mainframes in historical research in the laboratory of historical information sciences. ... Senior laboratory assistant (2) . ...

Еще в разделе: (Показать все результаты (>13) - www.hist.msu.ru/ )

• Historical sources on the history of Russia

The Department of Talented Youth Affairs and Professional Orientation . ... Newer posts . Posted on 01.12.2015 by editor . In 2015, as part of the National Strategy of actions in interests of childrenљthe Interdisciplinary Research and Education Center for Childhood Fundamental Studies was created in the Human Research Institute of Moscow State University. ... Posted in News , Без рубрики | ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>40) - talant.msu.ru/ )

• International Student Olympiad in Iran | The Department of Talented Youth

... О Школе . ... ВШБ МГУ - школе . ... Выпуски журнала . Выпуск 1/2009 Выпуск 1/2010 Выпуск 2/2010 Выпуск 1/2011 Выпуск 2/2011 Выпуск 1/2012 Выпуск 2/2012 Выпуск 1/2/2013 Выпуск 1/2/2014 . ... Менеджмент Выпуски журнала Выпуск 1/2/2014 . ... Эволюция моделей бизнеса в киноиндустрии России . ... Автор рассматривает формы международных проектов, существующие в мировой образовательной практике, а также делится опытом их реализации в Высшей школе бизнеса МГУ имени М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>127) - www.mgubs.ru/ )

• Выпуск 1/2011 | Высшая школа бизнеса МГУ им. Ломоносова
• Выпуск 2/2011 | Высшая школа бизнеса МГУ им. Ломоносова
• Электронные библиотеки и ресурсы | Высшая школа бизнеса МГУ им. Ломоносова

... Two-dimension linear regression model. ... The econometric modeling of time series . ... The course aims to provide students with basic models and methods of econometric modeling of financial time series. ... The course considers in detail the major methods of econometric modeling of time series, in particular modeling by stochastic processes, modeling of stationary and non-stationary time series, the spectrum analysis of time series. ... The problem of tax optimization under a given state budget. ...

Еще в разделе: (Показать все результаты (>18) - io.cmc.msu.ru/ )

Hybrid and Glueball Production on Nuclear Target V.L.Korotkikh, L.I.Sarycheva Moscow State University, Institute of Nuclear Physics 119899, Moscow, Russia e­mail: vlk@lav.npi.msu.su Abstract. We propose an experiment at moderate energies in which A­ dependence of Exotic meson production is measured. The main aim of such study is the measurement of the interaction cross­section of Exotic resonances with nucleon. ... We propose to study the exotic meson production on nuclei at moderate energy. ...

Еще в разделе: (Показать все результаты (>52) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~igor/seminar/golovin_111214.pdf
• http://lav01.sinp.msu.ru/~igor/seminar/zhigareva_23-04-13.pdf

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... October 9, 1997 . Hale-Bopp and the North American Nebula . ... Explanation: Comet Hale-Bopp 's recent encounter with the inner Solar System allowed many breath-taking pictures. Above, Comet Hale-Bopp was photographed on March 8th in the constellation of Cygnus . ... The North American Nebula is about 1500 light years away, much farther than the comet, which was about 8 light minutes away. ... About APOD > . ...

Еще в разделе: (Показать все результаты (>10) - www.arcetri.astro.it/ )

The Astronomical Journal welcomes new submissions at IOP Publishing . ... From: Andrew Wray < andrew.wray@iop.org > . ... On behalf of the IOP-AAS Project Team, I am delighted to announce that IOP Publishing is now processing all new submissions to the AJ. Submitting a new article . To submit a new article to the journal, go to http://authors.iop.org/aj , where you will find our beta version of the new AJ web submission site. ... Refereeing an article . ... IOP Publishing . ...

Еще в разделе: (Показать все результаты (>82) - sai.msu.ru/ )

... Recently Professor Bagotsky summarized his uniquely long scientific work in a brief article "Fuel Cells, Batteries, and the Development of Electrochemistry" published in the "Electrochemistry ­ Past, Present, and Future" issue of J. Solid State Electrochemistry(Vol.15,p.1559,2011).Hementionedthatbecause he was working simultaneously in the fields of fundamental and applied electrochemistry, he had the opportunity to experience the mutual influence in the development of these two fields. ...

Еще в разделе: (Показать все результаты (>65) - electr003.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/~natasha/nr_publ.html
• Alexander M. Kuznetsov

. Name . Last modified . Size . Description . Parent Directory . - . education/ . 31-Oct-2007 14:46 . - . Apache/2.2.16 (Debian) Server at educenter.sinp.msu.ru Port 80

Еще в разделе: (Показать все результаты (>5) - educenter.sinp.msu.ru/ )

• Index of /sections/education
• Index of /sections/education/seminars
• Index of /

Emb edding formulae for diffraction by wedge and angular geometries B y R. V. Craster1 A. V. Shanin 1 2 2 Department of Mathematics, Imperial Col lege of Science, Technology ... London SW7 2BZ, U.K. Department of Physics (Acoustics Division), Moscow State University, 119992, Leninskie Gory, Moscow, Russia Embedding is the process of taking the far field directivity from a diffraction problem (or problems) involving line sources or multipoles placed at a sharp ... The Wedge, pp. ...

Еще в разделе: (Показать все результаты (>43) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/prsla02.pdf
• A.V.Shanin

... В работе рассматривается двухмерная математическая модель лесных пожаров, приводится алгоритм численного решения и результаты тестовых расчетов. ... В работе [1] была предложена двухмерная модель лесных пожаров, построенная методом осреднения исходных трехмерных уравнений газовой динамики по высоте слоя лесных горючих материалов, который рассматривается как одноярусная двухфазная (газовая и твердая фазы) двухтемпературная реакционноспособная среда. ... Газовая фаза: . ... коэффициент диффузии, . ...

Еще в разделе: (Показать все результаты (>28) - www.library.biophys.msu.ru/ )

Home Search Collections Journals About Contact us My IOPscience The role of scattering on atomic nucleus and of electron state entanglement in single ionization of He by ion impact This article has been downloaded from IOPscience. ... In inelastic scattering, due to the orthogonality of one-electron states, the transitions of different electrons are summed in the amplitude with all other electrons non-active. ... Chem. 45 125. where fppf is the ordinary amplitude of elastic scattering. ...

Еще в разделе: (Показать все результаты (>102) - danp.sinp.msu.ru/ )

• SECTION 1 Title 1 Title 2 Title 3
• ?????????? ??????????? ?????????

... Resources . ... info@ecfs.msu.ru . All contacts . ... Eurasian Center . for Food Security . ... Comments: 0 . 15 october 2015 . ... Agriculture and the rural sector in general, is a major determinant of livelihoods in Europe and Central Asia (ECA). ... In Central Asia/Caucasus, most of the poor are in rural areas, where agriculture employs half of the population. ... International Forum on Eurasian Food Security and Nutrition Network and Eurasian Soil Partnership read . ... Contacts . ...

Еще в разделе: (Показать все результаты (>60) - ecfs.msu.ru/ )

• Forums | ECFS
• Ongoing consultations/ Текущие онлайн конференции | ECFS

Сюда надо поместить Ваш пароль: . Чтобы получить hash: . Можете скопировать его (Ctrl-A) из поля

158. Ученые детям