... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...
... The luminescence time dependence for two types of core/shell QDs (CdSe/CdS and CdTe/CdSe ) were investigated and were compared with behavior of naked ones (CdSe). ... Three different types of QDs were used in this work: simple core CdSe QDs, core/shell CdSe/CdS QDs and type II core/shell CdTe/CdSe heterostructures in charge carrier division regime (Fig.1). ... So core/shell nanocrystals demonstrate intermediate behavior between CdSe core-type QDs and CdTe/CdSe core/shell heterostructures. ...
... The Lectures Contents: Lecture one: Contemporary Historical and Political Background Part One: The Historical Stages of the Arab Political Development Part Two: The Nature of the Arab Political Systems and the Arab Modern Wars Lecture Two: The Middle East Scenario of Crisis and Conflict Part One: The Israeli/Palestine Crisis Part Two: The Superpowers' Role in the Arab Affairs Lecture Three: The Arab Modern Regional Politics Part One: The Arab Politics towards its Unitarian Movements. ...
ЛАБОРАТОРИЯ . АВТОМАТИЗИРОВАННЫХ . ... 20 1 3 г. 20 1 2 г. 20 1 1 г. 20 1 0 г. 2008 г. 2007 г. Публикации сотрудников лаборатории 2009 г. Сборники . ... Рафаева А.В. Научная, "наивная" и фольклорная картина мира // Педагогические технологии. ... Kazakevich, Olga. Language changes speeded up // The 16 th World Congress of the International Union of Anthropological and Ethnological Sciences. ... The 16 th World Congress of the International Union of Anthropological and Ethnological Sciences. ...
Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...
... Scientific goals . Cosmic rays of extremely high energy . ... Magnetospheric particles and radiation conditions . ... Scientific equipment . ... An attempt to register cosmic rays of extremely high energy of ~10 19 -10 20 eV, i.e. in the region of GZK-cut-off, . Today in high energy region we have only limited and contradictory information about the energy spectrum and chemical composition of the particles. ...
Asteroids, Comets, Meteors (2008) 8010.pdf SPECTRAL SIGNS OF CARBONACEOUS CHONDRITIC MATERIAL ON (21) LUTETIA V.V. Busarev, Sternberg Astronomical Institute (SAI), Moscow University, Universitetskij pr., ... We have discovered considerable variations in the continuum slope and shape of the visible-range reflectance spectra of the asteroid with rotation in November 2004 (4/5, 5/6 and 7/8) and March 2006 (3/4). ... Resulting normalized (at 0.55 m) and smoothed reflectance spectra are shown in Fig. ...
Uneex . SeminarTraffic . ... Анализ трафика -- зачем это нужно. ... Источники информации о трафике. ... Cisco accounting и NetFlow ( вот тут информации недостаточно, если кто-то может рассказать про эту часть -- хорошо ). ... В формате SXI (ooImpress) . ... Обзор биллинговых систем и систем учета трафика: http://www.opennet.ru/prog/sml/47.shtml . ... Интересная разработка: система адаптивного агрегирования информации о трафике. http://camelot.iki.rssi.ru/RFFI-02-07-90390 . ... Action: . ...
... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...
ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Компания HP создает новые возможности для того, чтобы технологии приносили максимальную пользу людям, компаниям, государственным структурам и обществу в целом. ... Бизнес HP в России уже 6 лет подряд показывает результаты лучше рынка ИТ в целом. ... Вакансии компании Hewlett-Packard: . ... Телефон компании HP: +7 (495) 797-35-00. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ...
Division of Geology . ... Division of Hydrogeology and Engineering Geology . ... Faculty of geology > English > Divisions & Departments . ... The graduates of "Engineering geology" specialization must have a vast geological background and know the state-of-the-art methods of studies and forecast of engineering-geological conditions for industrial, urban, hydrotechnical, road and underground construction. ... 119899, Russia, Moscow, Leninskie gory, Moscow State University, Faculty of geology. ...
... Поиск по МГУ | Лента новостей | ... Новости . ... Протестующие в Гонконге используют для связи разработанный выпускником мехмата МГУ имени М.В. Ломоносова мессенджер . Комментарии к новости: Протестующие в Гонконге используют для связи разработанный выпускником мехмата МГУ имени М.В. Ломоносова мессенджер . ... Они перешли на разработанный выпускником мехмата МГУ имени М.В. Ломоносова мобильный мессенджер FireChat, который использует Wi-Fi и Bluetooth. ... 2003 2011 MsuNews.Ru Новости МГУ . ...
... Electronic journal Issue 4. 10 september 2004 Briedis V. Pareto Structures A great Italian economist Vilfredo Pareto (1848 1923) in his unique economics and sociology studies [1, 2] continuously emphasised the systematic approach, reviewing the society development problems. ... Formal model of Pareto Structure First of all, provide a formal mathematical model adequately featuring the Pareto Structure. ... Indeed, I was primarily interested in the classical (harmonic structure) model at s = 1. ...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./briedis.pdf -- 388.0 Кб -- 06.07.2014 Похожие документы
... Магистерское образование . ... Enterprise Information Infrastructure . This course is focused on enterprise infrastructure and integration technology. Course presents different approaches to enterprise architecture and modern solutions of information infrastructure problems. Course?s topics cover strategies that help large enterprises to increase the agility of their IT systems. ... Enterprise portal technology, including collaboration and knowledge management . ... FI- Master data . ...
... SDPpred is a tool for prediction of residues in protein sequences that determine functional differences between proteins, having same general biochemical function. ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ...
... Submit your article . ... The article reveals peculiarities of the development of the high-tech sphere in the global economic environment. ... The role of venture ecosystem as a source of development of the high-tech sphere is examined in the article. The author identifies the problems of development of Russian venture ecosystem and demonstrates its prospects of an effective symbiosis of the state and the private initiatives against the background of favourable institutional conditions. ...
Press release 20 July 2011 New funding for early-career top researchers from anywhere in the world: 730 million for new "ERC Starting Grant" call The European Research Council (ERC) today opens its fifth call for proposals for the "ERC Starting Grants", targeted at early-career top researchers of any nationality, working - or moving to work - in host institutions in Europe. ... Last year, the success rate of Starting Grants proposals was around 15%. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Научные семинары . ... расписание семинаров . семинар 1 . ... Отчет о семинаре || ... This talk will focus on one of the emerging technology for solar light conversion into electricity; the dye-sensitized solar cell. ... The present lecture will give a general background to the solar energy field with a focus on dye-sensitized solar cells. ... С докладом Dye-sensitized Solar Cells Materials and Interfaces выступил профессор Lars Kloo из Королевского технологического института г. Стокгольма. ...