... November 9, 1999 . Spiral Galaxies in Collision . ... the Hubble Heritage Team ( AURA / STScI / NASA ) . ... Until then, spiral galaxies NGC 2207 and IC 2163 will slowly pull each other apart, creating tides of matter, sheets of shocked gas , lanes of dark dust , bursts of star formation , and streams of cast-away stars . Astronomers predict that NGC 2207, the larger galaxy on the left, will eventually incorporate IC 2163, the smaller galaxy on the right. ... About APOD > . ...

Еще в разделе: (Показать все результаты (>21) - www.arcetri.astro.it/ )

• APOD: April 9, 1999 - WR 104: Pinwheel Star

... Inorganic Materials Sciences . ... At the same time at the Faculty of Physics and Mathematics of the Moscow University was founded the Inorganic Chemistry Division which was later transformed into a separate Department of Inorganic Chemistry of the MSU Faculty of Chemistry . ... The latter part of this program is successfully realized at both the Deartment and at the Department of Materials Sciences , the new faculty of MSU, which creation was initiated by the department of Inorganic Chemistry. ...

Еще в разделе: (Показать все результаты (>10) - www.inorg.chem.msu.ru/ )

... Регистрация . ... Форумы > Аспирантура > Регистрация . ... Please, enter the code that you see below in the input field. This is for blocking bots that try to post this form automatically. If the code is hard to read, then just try to guess it right. If you enter the wrong code, a new image is created and you get another chance to enter it right. ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>6366) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное
• MMOnline | Форумы | Абитуриентам
• MMOnline | Форумы | Первокурсникам

... Написать комментарий . ... В наружном кольце преобладают яркие голубые звезды, а в центре находится шар из гораздо более красных звезд, которые, вероятно, значительно старше. ... Спиральная галактика с перемычкой NGC 1365 это действительно величественная островная вселенная, размер которой около 200 тысяч световых лет. ... Это скопление, известное также под именем Каппа Южного креста, насчитывает свыше ста звезд, а его возраст составляет около 10 миллионов лет. ...

Еще в разделе: (Показать все результаты (>41) - www.nature.web.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

. Faculty of Mechanics and Mathematics, . M.V. Lomonosov Moscow State University . This site is created and supported by . the A.M. Liapunov French-Russian Institute . of Moscow State University .

Еще в разделе: (Показать все результаты (>24) - new.math.msu.su/ )

... Кризис американских исследовательских университетов. Университеты и управление. Ключевые слова: Наука в университетах. ... СТАТЬИ . ... ЗАРУБЕЖНЫЕ УНИВЕРСИТЕТЫ. ... Guildford, 2002. ... Рекомендации правительства Великобритании по преодолению разрушения исследовательской инфраструктуры университетов. ... Научные достижения Ягеллонского университета в Кракове в 2001 г. и в перспективе до 2002 г. Ключевые слова: Наука в университетах. ... ОТДЕЛЬНЫЕ УНИВЕРСИТЕТЫ. ... Тамбовский университет. ...

Еще в разделе: (Показать все результаты (>49) - srcc.msu.ru/ )

• Университетское образование в мире.Чехия
• Alexey N. Romanov, Zukhra T. Fattakhova, Denis M. Zhigunov, Vladimir N.
• A.Romanov, Z.Fattakhova, D.Zhigunov, V.Korchak, V.Sulimov // On the origin of

... Information on your customer account . ... Brazil British Indian Ocean Territory Brunei Darussalam Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote D'Ivoire Croatia Cuba Cyprus Czech Republic Denmark Djibouti Dominica Dominican Republic East Timor Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland...

Еще в разделе: (Показать все результаты (>34) - www.bukivedi.ru/ )

ACCL: what is that and what it is for . Animal Cell Culture Laboratory (ACCL) of the Faculty of Bioengineering and Bioinformatics was created in 2001 as one of the first service groups located in Laboratory Building Б of Moscow State University . ... Other persons are also welcome on the terms of individual agreement (see Services and Scientific Program ). We also have our own program of scientific research (see Scientific Program ). ...

Еще в разделе: (Показать все результаты (>165) - www.genebee.msu.ru/ )

• BLAST Frequently Asked Questions (FAQ)

... IMPACT: New carbon-based materials with exceptional chemical and physical properties . ... AREA: Condensed Matter Physics, Physical Chemistry, Structure and Dynamics of Atomic-Molecular Systems, Engineering Sciences and Mechanical Engineering . ... Moscow State Uiversity . ... STRATEGY: Application of ab initio methods for simulation of forbidden reflections energy spectra taking into account thermal displacements of atoms and protons fluctuations. ... AREA: Condensed Matter Physics . ...

Еще в разделе: (Показать все результаты (>40) - hpc.msu.ru/ )

• SIGMA: Collective Bank of Tests on Parallel Computing | Moscow University
• Supercomputing Education Project | Moscow University Supercomputing Center
• Nationwide Supercomputing Education Project | Moscow University Supercomputing

... Only by numerical simulation. ... moment T (K) Dipole moment (D) Experiment Other example: Diffusion constant 200 250 298 350 400 2.40 2.37 2.48 2.59 2.80 2.25 The Distribution functions: radial distribution function 1 g (r) = N t =1 j i N TS N pair ( r - rij ) The Distribution functions: radial distribution function CC def 2 Work mode ­ computer related 1) · Perform simulation , create trajectory file · Calculate properties timestep by timestep 2) · Perform ...

Еще в разделе: (Показать все результаты (>13) - www.elch.chem.msu.ru/ )

... Dahl's texts and dictionaries in the Web (in Russian) . ... Employees of the Laboratory . ... About Laboratory . ... Anatoly Anatol'evich Polikarpov - a head of the laboratory - professor of Russian Language Department [ click here for personal information ] . ... About the laboratory . ... Development of techniques of gathering and analysis of mistakes of foreigners in Russian speech (a series of works of 1985-1991 under the leadership of A.A.Polikarpov with principal assictance by O.V.Kukushkina);...

Еще в разделе: (Показать все результаты (>37) - old.philol.msu.ru/ )

• Human Language - Язык Человека
• MSU-LGCLL:: Papers submitted to QUALICO-94

... Institutes of Chernogolovka . The largest of all the scientific institutions of the center is the Institute of Chemical Physics in Chernogolovka , where fundamental problems of chemical physics are studied: kinetics and mechanisms of chemical and biological processes; processes of combustion, explosion, and polymerization; and mechanisms of elementary reactions involving high energy particles. ... Developments and Technologies . ...

Еще в разделе: (Показать все результаты (>10) - www.issp.ac.ru/ )

• Chernogolovka
• Olympiad of Scientific Centres
• Gavrilov M.G. "Zviozdnyj Mir", vol.IV

Программные средства построения интернет-атласов . ... В работе описывается разрабатываемая в НИВЦ МГУ технология и поддерживающие ее программные средства комплексного отображения разнородной пространственно распределенной информации, в том числе в среде Интернет. ... Описываемая технология состоит в подготовке на инструментальной машине файлов (HTML-страниц, файлов с программами управления данными и их визуальным представлением и файлов данных), представляющих собой Интернет публикацию. ...

Еще в разделе: (Показать все результаты (>17) - adept.srcc.msu.ru/ )

Создание и оценка цифровых моделей рельефа высокой точности для урбанизированных территорий на основе цифровой картограф. продукции. Creating and evaluating high resolution DEM's for an urban environment from digital cartographic products / Carter J. R., Tripathy D. // 21 International Cartographic Conference "Cartographic Renaissance", Durban , 10-16 Aug., 2003. ... Durban, 2003, 10-16 Aug., ... С. 1851-1858. ...

Еще в разделе: (Показать все результаты (>3) - ecoinformatica.srcc.msu.ru/ )

... The given course consisting of lectures and seminars is aimed at teaching our students a whole range of measures, which allow quick and efficient faultfinding, functional testing, reliability testing of a device, find replacement for a faulty component at the modern technological level, fix a device, create a similar device even without the blueprints. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ...

Еще в разделе: (Показать все результаты (>13) - engineering.phys.msu.ru/ )

... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>14) - hcs.cmc.msu.ru/ )

... О проекте . ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... The layout of beam-lines and experimental stations intended for the applications of the X-ray laser-electron generator to the investigation of the elemental composition, material structure and biological objects is discussed. ...

Еще в разделе: (Показать все результаты (>6) - miles.sinp.msu.ru/ )

. This crossword was created with EclipseCrossword - www.eclipsecrossword.com . 1 . 2 . 3 . 4 . 5 . 6 . 7 . 8 . 9 . Этот кроссворд был создан freeware EclipseCrossword

160. MAU_main_e