... ОТЧЕТЫ СТУДЕНТОВ О ПРАКТИКЕ В САО . Лето 2001 года . ... Гришатовой Юлии . ... Для определения лучевых скоростей, FWHM (полной ширины на половине максимума) и интенсивности линия He I 6678.15А описывалась гауссианой ( рис.1 ). ... create/icat {P1} ztsh*.bdf . execute/catalog @@ set_lambda {P2} . execute/catalog @@ timing {P2} . execute/catalog @@ phase {P2} . ... create/table {P1}.tbl . ... create/column {P1}.tbl fwhm . execute/catalog @@ add_rv_curve_point {P2} {P1}.tbl . ...

Еще в разделе: (Показать все результаты (>12) - heritage.sai.msu.ru/ )

... The Laboratory of Programming Technologies was established in 2001. The Laboratory's team consists of collaborators and graduate students of Computer System Automation Department that work under supervision of Professor Igor Mashechkin. ... series of works for research and development of multi-functional cross-programming system. ... Presently the main scientific direction of the Laboratory is research and development of algorithms and methods for creating data mining software. ...

Еще в разделе: (Показать все результаты (>129) - en.cs.msu.ru/ )

• Laboratory of Programming Technologies | CMC MSU
• Laboratory of Ternary Informatics
• Department of Supercomputers and Quantum Informatics | CMC MSU

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

Еще в разделе: (Показать все результаты (>2) - saistud.sai.msu.ru/ )

... Publications . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Lomonosov Moscow State University . ... Publication type . Conference paper . ... Publication date . ... Conference . 17-th International Conference on Computer Graphics GraphiCon'2007 . ... Moscow, Russia . ... BookTitle = {17-th International Conference on Computer Graphics GraphiCon'2007}, . ... Address = {Moscow, Russia}, . ...

Еще в разделе: (Показать все результаты (>98) - imaging.cmc.msu.ru/ )

• Basic edges | Laboratory of Mathematical Methods of Image Processing

Magnetism Department MSU . ... Magnetism department . ... Magnetic Laboratory was created in Moscow State University by professor Vladimir Arkad ev. ... In 1918 Arkad ev returned in MSU where he founded Moscow Magnetic Laboratory, which exists for a long time on the enthusiasm of their members. ... As the head of new department professor Nikolay Akulov was assigned. ... During the period since 1954 till 1987 the head of magnetism division was Eugeny Kondorsky. ... Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>19) - magn.phys.msu.ru/ )

... Shipping Icons . E-Commerce Icons . Building Icons . Hosting Icons . ... But to make your website or interface design a real eye-catcher there was one thing missing: Icons! Icons are an essential tool to simplify user interfaces and today almost every major website uses icons to highlight important parts in their content. ... Visit Website . ... escort beylikduzu bayan escort escort bayan escort escort istanbul escort bayan porno film escort istanbul escort beylikduzu escort bayan ...

Еще в разделе: (Показать все результаты (>5) - physcontrol.phys.msu.ru/ )

• List All Categories
• Widgetkit

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... C. Gibbons, M. Locke: Cupid and Death - Fourth Entry . К. Гиббонс, М. Локк: Купидон и Смерть - Явление четвертое . ... The scene is changed into a pleasant Garden, a fountain in the midst of it; walks and arbours delightfully expressed; in divers places, Ladies lamenting over their Lovers slain by Cupid , who is discovered flying in the air. ... Enter a Lover , playing upon a lute, courting his Mistress; they dance. ... Enter Cupid . ... If it be death to love, what will it be . ... Enter Death .) ...

Еще в разделе: (Показать все результаты (>85) - music.genebee.msu.ru/ )

• H. Purcell: The Fairy Queen - Act II
• MSU Chamber Orchestra. Hystory.
• J.-B. Lully: Cadmus et Hermione - Acte V

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>3) - swx.sinp.msu.ru/ )

Given word length and max number of mismatches . Use MEME algorithm for define conserved blocks . Apply the Dynamic programming algorithm to create chain of the blocks . Refine the chain using combined profile for chain of blocks. ... Reduce word length and number of mismatches and repeat the procedure for spacer between the blocks. ... Create helix profile and apply MEME-like iterative procedure to find sets of helices that consistent lokated reative to conserved blocks . ...

Еще в разделе: (Показать все результаты (>11) - bioinf.fbb.msu.ru/ )

• User's guide
• SDPlight

... Conference Venue . ... Latest achievements in the field of humic substances and natural organic matter (NOM) research . Theory and practice of a directed use of humic substances and other biologically active compounds in crop production and animal feed . ... Organic farming and ecoadaptive agriculture: the role of humic substances and other biologically active compounds . ... The school on isolation of humic substances (HS) using solid phase extraction (SPE) cartridges . ...

Еще в разделе: (Показать все результаты (>137) - mgumus.chem.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>4) - npidb.belozersky.msu.ru/ )

Communicating Through Art, L.Vershbow . ... But here I am, and as a designer, I will attempt to explain to you how I perceive art and design as a form of communication. Most of us think of art as the works that hang in museums and on the walls of our homes. ... But art, design and symbols, whether they are aesthetically pleasing or not, are all around us, and they help to guide us through the complexities of everyday society. ... Today I am a designer and creator of contemporary jewelry. ...

Еще в разделе: (Показать все результаты (>34) - suny.msu.ru/ )

... 6:30 - 7:00pm |Transit to Executive Learning | ... 8:00 - 10:00pm |Dinner |Executive Dining Room | ... 10:30 - 10:45am |Funds |Executive Dining Room | Claude Legrand |10:45am - 12:30pm|Refreshment Break |ELC x.206 | ... 10:30 - 10:45am |Refreshment Break |Executive Dining Room | ... Lunch |Executive Dining Room | ... 2:30 - 2:45pm |Refreshment Break |Executive Dining Room | ... 4:00 - 4:15pm |Refreshment Break |Executive Dining Room | ... 5:15 - 5:30pm |Refreshment Break |Executive Dining Room | ...

Еще в разделе: (Показать все результаты (>2) - www.innovation.msu.ru/ )

• http://www.innovation.msu.ru/SEEC-LMSU_Detailed_Program_Itinerary_Nov4-Nov12_2007.doc

... Electronic journal Issue 4. 10 september 2004 Vorontchuk, Cox III R.W. Developing a Competency-based Career Training and Professional Development Program for Latvia INTRODUCTION. ... With the support of a grant from the NISPAcee a team from the Latvian School of Public Administration, the University of Latvia and the University of Akron (Ohio, USA) prepared for the Chancellery of Latvia a proposal for the creation of a career-long professional development program for those in the civil service. ...

Еще в разделе: (Показать все результаты (>9) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./leigh.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./paliulis_chlivickas.pdf

... Change password . Please enter the checkword and your new password . Login . Checkword . New password Confirm password . Recover password . ... Please log in. ... Password . ... Forgot password? Password request . Send me checkword . ... E-mail . ... If you cannot remember your password, enter your login or e-mail you have used for registration. A message containing the check word you can use to change the password will be sent to your e-mail. ... One-time password . ...

Еще в разделе: (Показать все результаты (>7) - www.ffl.msu.ru/ )

• Get Password - Факультет иностранных языков
• Authorization - Факультет иностранных языков

... The Russian Federation Presidential Commission on the modernization and technological development of Russian economy Project "Formation of Highly Qualified Supercomputing Technology and Dedicated Software specialist training system" is now complete. ... Lomonosov Moscow State University, . ... The nationwide system of Research and Education Centers for Supercomputing Technologies (REC SCT), incorporating all Russian Federal Districts, formed the basis for the successful implementation of the project...

Еще в разделе: (Показать все результаты (>47) - hpc.msu.ru/ )

• APPLICATIONS: Condensed Matter Physics | Moscow University Supercomputing...
• SIGMA: Collective Bank of Tests on Parallel Computing | Moscow University
• APPLICATIONS: Aerophysics | Moscow University Supercomputing Center

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>5) - sinp.msu.ru/ )

... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>29) - cdfe.sinp.msu.ru/ )