... We will dwell on linguistic aspects and Lexical Resources of POLITEXT branch having in mind some intermediate semantic representation of a whole text as the basis for differentiated Information Extraction. It is personal data (in the social sphere) recognition in texts that we focus on, see (Leontyeva et al. ... As the main instrument of semantic analysis of coherent texts this dictionary bears the important information on how to build BTF-units starting from lexemes of SemDict entries. ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Semantic Dictionary for Text Understanding and Summarization
• Semantic Resources for Textual Content Compression

... В.Е.Фортов, В.К.Грязнов, А.А.Леонтьев, В.Б.Минцев, В.Е.Беспалов, Ю.В.Иванов IV Всесоюзная конференция по физике низкотемпературной плазмы. ... Experimental study of a dense xenon plasma under high pressures. V.B.Mintsev Proc. of 2-d Int.workshop on non-ideal plasmas. ... Yu.B. Zaporogets, V.B.Mintsev, V.E.Fortov In book: Current topics in shock waves, New York, 1989, p.549-555. ... Strongly coupled plasma physics at megabar pressures V.E.Fortov, V.B.Mintsev In book: High Pressure phenomena. ...

Еще в разделе: (Показать все результаты (>4) - www.test.physchem.msu.ru/ )

... Registration and Abstract submission are open for the International Conference on Physics Education ICPE 2014 , that will take place at the Sheraton Cordoba Hotel & Convention Center, C rdoba, Argentina, on August 18th to 22th, 2014. ... Keynote Speaker: Cedric Linder , Professor of Physics Education Research, Division of Physics Education Research, Department of Physics and Astronomy, Uppsala University, Sweden. ... Prof. Zulma Gangoso (Chair) . ... Prof. Zulma Gangoso (Argentina) . ...

Еще в разделе: (Показать все результаты (>10) - foroff.phys.msu.ru/ )

... Большая часть материала была собрана на Звенигородской биостанции (ЗБС) МГУ на мухоловке-пеструшке ( Ficedula hypoleuca ) . ... С. 31-32. [скачать pdf-файл] . ... С. 278-295. [скачать pdf-файл] . ... Bushuev A.V., Ivankina E.V., Kerimov A.B, 2003. Factors influencing resting metabolic rate of Pied Flycatcher fledglings (Ficedula hypoleuca Pallas) // Vogelwarte (Abstract Volume 4 th Conference of the European Ornithologists' Union. ... Bushuev A.V., Ivankina E.V., Kerimov A.B., 2006. ...

Еще в разделе: (Показать все результаты (>30) - vertebrata.bio.msu.ru/ )

• Sergei V. Ogurtsov
• Student Reports at International Conferences
• Выступления студентов и аспирантов на конференциях

... The mo del is a directed dyadic acyclic graph. ... New vertexes are added one by one. The probability of this addition dep ends on the structure of existed graph. ... 4 (2 ) FIGURE 4: The probabilities of different variants to add a new vertex to the future in the step number 500. pij is the probability to add a new vertex to the outgoing external edges numbers i and j . Similarly, p is the probability to add a new vertex to the incoming external edges numbers and . ...

Еще в разделе: (Показать все результаты (>14) - temporology.bio.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/krugly_unfaithful.pdf

... Animal Biology [Anim Biol] . Common information . ... since 2003-09-01 till today . ... biology ->zoology . ... Formerly known as Netherlands Journal of Zoology . ... http://www.vsppub.com/journals/jn-Ani.. ... 2003-09-01 . today . toc, abstract . http://lysander.ingentaconnect.com/vl... 2003-09-01 . ... http://www.ingentaconnect.com/content... 2003-09-01 . ... http://www.vsppub.com/jconts/ab/index... 2006-01-01 . ... http://www.ingentaconnect.com/content.. ...

Еще в разделе: (Показать все результаты (>997) - journals.genebee.msu.ru/ )

CUDA Center of Excellence NVIDIA 22 « » ­ NVIDIA HPC Day. NVIDIA, , . Wen-mei W. Hwu (), , . 9:30 -- 10:00 10:00 -- 11:30 The Future of GPU computing Prof. Wen-mei W. Hwu 11:30 -- 12:00 Introducing Kepler: new generation GPU architecture Mark Ebersole , , 12:20 -- 13:20 , .. , .. , .. , .. 13:20 -- 15:00 GPU CUDA Prof. Wen-mei W. Hwu - « » : 2- , . 238 : http://ccoe.msu.ru

Еще в разделе: (Показать все результаты (>4) - ccoe.msu.ru/ )

• OpenACC: Вычисления на GPU с помощью простых директив | GPU Center of

Converters . A converter from ASCI GRD (Surfer, Golden Software Inc.) files into IPI data format. A converter from Res2dInv and IRIS SysCal files (Windows) . ... Runtime Error 200 - 'Divide by 0' on fast PCs. ... The cause of this error is a bug of Borland Pascal 7 . Now we found the way to solve this problem (on page "Fix for Borland Pascal" ). ... 119899, Russia, Moscow, Moscow State University, Geological Faculty, Department of Geophysics, Bobachev Alexei . ...

Еще в разделе: (Показать все результаты (>27) - geophys.geol.msu.ru/ )

• Page 3. Publications

... Mathematical models and methods in VLSI design . ... General models and statements about the complexity of combinatorial tasks, methods for development of fast algorithms (method of dynamic programming, ?divide and conquer?, ?method of model extension?) are considered. ... Mathematical models of contemporary electronic circuits are considered and basic approaches to solving task of logic synthesis, as well as tasks of VLSI modules placement and interconnection routing are described. ...

Еще в разделе: (Показать все результаты (>4) - hcs.cmc.msu.ru/ )

... Input parameters Key parameters: - sqrt(s), GeV N events ­ total number of events A number of target/projectile B min, B max ­ impact parameters (in fm) for all events Choice of parton-hadron conversion scenario (AMPT model, AMPT with string and others) Parameters for Lund fragmentation Quenching flag (on\off) K short decay flag, other flags Output parameters Output file: ampt.dat, containts: Event number Impact parmeter Total number of participants n. in proj. ...

Еще в разделе: (Показать все результаты (>36) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~vlk/CONF3_report.ps
• http://lav01.sinp.msu.ru/~vlk/pbarp_mypreprint.ps
• http://lav01.sinp.msu.ru/~vlk/3pi0.ps

... opt/atlas/12.0.8/cmtsite/setup.sh -tag=<release>[,<mode>] # # projects # . opt / atlas / 12.0.8 / cmtsite /setup.sh -tag= project , release [, mode ] # # Report bugs to hn- atlas -releaseKitProblem@cern.ch , atlas -sw-installation@cern.ch . # set CMTSITE STANDALONE set SITEROOT / opt / atlas / 12.0.8 macro ATLAS_DIST_AREA ${ SITEROOT } # use optimised version by default apply_tag opt apply_tag setup apply_tag projectArea ...

Еще в разделе: (Показать все результаты (>2) - lhe.sinp.msu.ru/ )

... О проекте . ... A specialized source of quasi-?monochromatic X-?ray radiation for medical application is proposed. It includes two electron storage rings (E = 50 MeV) placed in the vertical plane and two laser resonators located in the horizontal and vertical planes. Hard X rays are generated in a process of back Compton scattering of laser photons ~1eV by electrons in the linear paths of storage rings. ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

• Proposal of a Compact Repetitive Dichromatic X-ray Generator with Millisecond

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... This applet generates an observing list based on an observer's location and time. ... To use this program, enter in your location, and the local times at which you wish to begin and end observing. The date you enter should correspond to the calendar day at the time at which you begin observing. For example, if you wish to observe from 9:37 PM October 23, 2007 until 3:21 AM October 24, 2007, you would enter 21:37 for the starting time, 03:21 for the finish time, and 10/23/2007 for the date. ...

Еще в разделе: (Показать все результаты (>10) - observ.pereplet.ru/ )

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ­ velocity potential, H ­ depth, ­ vector of bottom deformation, 0 ­ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>14) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/pubs/Chashechkin-Waves.pdf
• http://ocean.phys.msu.ru/science/nosov/EGU2010_pumping.pdf

The file a_news.php had been edited by : IP: 193.232.121.99 Time: 22.12.2008|12:28:34 This message had been generated by http://www.web2ftp.com On abuse issues, please contact abuse@web2ftp.com

157. http://www.socio.msu.ru/vestnik/archive/2010/3/09.pdf

158. Support

159. The Laboratory of chemistry and physics of sensor and semiconductor materials |

160. http://www.msu.ru/work/GS_15.pdf