... education . ... Functional Nanomaterials . ... Composite Nanomaterials Master?s Program . ... admission in January 2010 . ... MSU Faculty of Chemistry announces a new Master?s Program in Composite Nanomaterials, 510500 Chemistry. The program is under the aegis of MSU Nanotechnology Education and Research Center. ... The program is aimed mainly at graduates and young scientists, including Candidates of Science, in chemistry or physics (additional higher education.) ...
... Информационный портал о карьере и работе для студентов и выпускников технических и естественнонаучных специальностей . ... Образование для карьеры . ... Регистрация и детали Дата обновления информации: 14 января 2013 г. Вернуться в раздел "Образование для карьеры" . ... Ярмарка вакансий "Формула карьеры" . ...
Declaration of the Higher School establishments of Russian Federation and People's Republic of China rectors' forum "The role of international cooperation in the Higher Education Quality Increase" We, the participants of the Higher School establishments of the Russian Federation and People's Republic of China rectors' forum, held in Moscow Lomonosov State University at September 06-07, 2007, based upon the understanding of: . ... holding Russian-Chinese science festivals; . ...
... Актуальная информация . ... Научный календарь МГУ Научная жизнь на ФГУ Конференции Научные семинары Международная конференция ФГУ International Conference Молодым ученым Электронные ресурсы Список полнотекстовых баз данных (журналы) Список полнотекстовых баз данных (книги) Список реферативных баз данных Материалы международных конференций Архив мероприятий Конференции Научные семинары Круглые столы Презентации Международная конференция ФГУ Фестиваль науки Международное сотрудничество . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
CURRICULUM VITAE SERGEY BALAKHONOV Lomonosov Moscow State University (MSU) Department of Materials Science , Inorganic Chemistry Division Laboratory MSU, Leninskie Gory 1/3, GSP-1, Moscow , 119991, Russia Name Born Nationality Age Marital state Home address Phone number Fax number E-mail Web Sergey Balakhonov 26.09.1987 in Bryansk, Russia Russian Federation 23 years old Unmarried 119991, ... Hydrothermal / solvothermal and hydrothermal-microwave synthesis. ...
[
Текст
]
Ссылки http://www.inorg.chem.msu.ru/matsci/hydrothermal/pdf/balakhonov_cv.pdf -- 32.2 Кб -- 01.02.2011 Похожие документы
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 15, 2013 1 - The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2013" 1. ... Administrative law 2. ... Members of the Council of Experts: Golichenkov Alexander Konstantinovich (Head of the Law Faculty, head of the chair of land and ecological law, Doctor in Law, Professor) Romanov Stanislav Vladimirovich (Deputy Dean on instructional work, Candidate in Law, Docent). ...
[
Текст
]
Ссылки http://www.law.msu.ru/bitcache/da2ecb4c4c1ad0c8d4c795e346afcf80b93bd045?vid=25267&disposition=attachment&op=download -- 302.6 Кб -- 25.02.2013 Похожие документы
... Destructive effects of many tsunamis are confined to areas within about one hour of the initial propagation time (that is, within a few hundred km of their source). ... Two international tsunami workshops have recently been held in Russia ( "Tsunami Mitigation and Risk Assessment," Petropavlovsk-Kamchatskiy,1996 , and "Tsunami Risk Assessment Beyond 2000: Theory, Practice and Plans," Moscow, 2000). ... The final product of the workshop will be recommendations on local tsunami warning and mitigation....
... Link] 23.04.10 14:17:24 anon : . MiKTeX версии 2.8 . Link] 22.04.10 15:13:38 anon : Вопрос по использованию стилевого пакета DMVN или russlh . ... Комментарий: . ... По программе во втором семестре есть и ТДФ и Мат. логика. ... Лекций по логике у нас, пожалуй, нет, но можно посмотреть материалы на сайте кафедры, там что-то точно выкладывали. ... А так же во втором семестре на "Теория дискретных функций". ... Link] 06.03.10 00:59:33 koky : бесконечно малые функции . ... 2016, DMVN . ...
... Geography of World Economy . ... Recreational Geography and International Tourism . ... Physical Geography and Landscape Science . ... About Faculty . ... Research laboratories . ... Field stations . Faculty branches . ... Education . Undergraduate study . ... Type of field courses . ... Russians, that have an education at university level, are allowed to study on government-sponsored places. Foreigners can receive only rental education, they have to conclude a contract with the faculty. ...
... This article caused a most lively interest from the readers, and received more than a hundred responses, which contained various versions of construction methods of the Sri Yantra. ... In this way he revealed a good correspondence between the concentric levels built by him in this relationship of the three Sri Yantra and the orbits of the planets of the solar system (Fig. 10, shows the first two out of three stars examined by him) with a divergence from the real diameters of orbits of about 1.5%. ...
[
Текст
]
Ссылки http://www.protein.bio.msu.ru/~akula/Kulaichev%20Addition.pdf -- 75.3 Кб -- 29.10.2013 Похожие документы
... каталоги . ... Введите данные для поиска . ... Каталоги: 51 . БЕН РАН - Журналы БЕН РАН - Каталог книг и продолжающихся изданий ВГБИЛ - Каталог Книги ВГБИЛ - Каталог Периодика ГПНТБ России - Электронный каталог ГПНТБ России ГПНТБ России - Российский сводный каталог по научно-технической литературе ИНИОН РАН - Электронный каталог с 1991 г. БИК.Финуниверситет - Основной каталог БИК.Финуниверситет - Книги Киб НБ МГУ - Электронный каталог Книг c 1990 г. НБ МГУ - Электронный ...
... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...
... О кафедре . English . ... Department for Jewish Studies of Lomonosov Moscow State University . ... The Department for Jewish Studies (DJS) was established in 1998. ... The students take courses offered by the School (the Institute of Asian and African Studies), as well as courses offered by the Jewish Studies Department. ... The Department regularly accepts university teachers of Jewish and Israeli Studies from Russia and the FSU in order to upgrade their professional level. ...
In McQual, D. & Windhal, S. Communication Models for the Study of Mass Communication . ... Одним из первых подходов в области анализа приема сообщений (reception analysis) был вариант критической теории, сформулированный Стюартом Холлом (1980). ... Модель кодирования/декодирования Холла (Hall 1980). ... Hall, S. (1980). Encoding, decoding in the television discourse. ... Morley, J. (1980). ... МакКуэйл Д., Виндал С. (1993/1998). Модель кодирования/декодирования . ...
... Поиск по МГУ | Лента новостей | ... Форумы > Новости МГУ > Тема . ... Презентация по машинному переводу от Google на коллоквиуме по базам данных в МГУ . 2-го июня в 11:00 во 2-м учебном корпусе МГУ (здание факультета ВМиК МГУ) состоится презентация исследователя из Нью-Йоркского отделения Google на тему: "Building a Large-Scale Machine Translation System" ("Построение масштабируемой системы машинного перевода"). ... 2003 2011 MsuNews.Ru Новости МГУ . ... Экспорт новостей (RSS) ...
Developer Notes To Build Your Own Custom GUI Job Submission Run Applications for PC-GAMESS / Firefly Input Files Upon Existing Bourne Shell Scripts And Open Source Developer Tools Obviously the methodology below is not the only way to build graphical job submission run applications on Apple Macintosh computers but I found it fast and easy (and all of the necessary developer tools are open source). ... These applications were built with the developer tools, settings and configurations described above. ...
[
Текст
]
Ссылки http://classic.chem.msu.su/gran/gamess/macosx/DEVELOPER-NOTES-FIREFLY-GUI-RUN-APPS-MAC.pdf -- 213.4 Кб -- 23.02.2009 Похожие документы
Lomonosov Moscow State University Biological faculty Botanical garden (Russia, http://botsad.msu.ru) Botanical garden of the Komarov Botanical institute (Russia) Russian Iris Society Botanical garden of Taurida National Vernadsky University (Ukraine) The first information letter Dear colleagues! ... Wide range of topics concerning representatives of genus Iris L. are planned to be discussed at the following sections: 1. ... Abstract submission deadline is Apr.1, 2011. ... Rodionenko G.I. Genus Iris. ...
[
Текст
]
Ссылки http://www.botsad.msu.ru/docs/eng_iris1.doc -- 440.0 Кб -- 20.02.2011
[
Текст
]
Ссылки http://botsad.msu.ru/docs/eng_iris1.doc -- 440.0 Кб -- 20.02.2011 Похожие документы