... To use RPM's PGP-related capabilities, you'll need to have PGP installed on your system. ... As we've discussed, PGP uses encryption to provide this privacy. ... Over and above PGP's legal status, there are other aspects to PGP that people living in the U.S. and Canada should keep in mind: . ... Versions of PGP approved for use in the U.S. contain a licensed version of this software, known as RSAREF. ... Otherwise, people living in the U.S. or Canada should use a version of PGP incorporating RSAREF....

Еще в разделе: (Показать все результаты (>262) - uneex.lorien.cs.msu.su/ )

• Открытая модель ПО в образовании: И применять, и изучать

... Osolodkin D.I., Kozlovskaya L.I., Dueva E.V., Dotsenko V.V., Rogova Y.V., Frolov K.A., Krivokolysko S.G., Romanova E.G., Morozov A.S., Karganova G.G., Palyulin V.A., Pentkovski V.M., Zefirov N.S . ... Osolodkin D.I., Palyulin V.A., Zefirov N.S. Glycogen synthase kinase 3 as an anticancer drug target: Novel experimental findings and trends in the design of inhibitors. ... Palyulin V.A., Osolodkin D.I., Zefirov N.S. Virtual Screening Workflow for Glycogen Synthase Kinase 3ѕ’ Inhibitors. ...

Еще в разделе: (Показать все результаты (>23) - qsar.chem.msu.ru/ )

• Radchenko, Eugene V. - Laboratory of Medicinal Chemistry

... pacifist : Re: The United States of America has gone mad [re:Agassi] 20.03.2003 16:55 | ... http://forum.local/user/upload/file53.jpg . ...

Еще в разделе: (Показать все результаты (>5322) - www.fds-net.ru/ )

• Синхронизация времени - Public forum of MSU united student networks
• They are Shanghai Jiao Tong University, Moscow State University... - Public
• Продаю sony play station 2 - Public forum of MSU united student networks

... In 1964 at the Institute of Mechanics of Lomonosov Moscow State University the laboratory of physical-chemical gasdynamics had been set up under the supervision of Tirskiy G.A., which employed a team of three scientists - Tirskiy G.A., Gershbein E.A., Suslov O.N.; before they worked in the general hydromechanics division. ... V.N. Chelomey Medal of Astronautics Federation of Merit for the National Astronautics (2004, Kovalev V.L., Sakharov V.I., Tirskiy G.A.). ...

Еще в разделе: (Показать все результаты (>10) - lab106.imec.msu.ru/ )

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>5) - www.eng.geogr.msu.ru/ )

• Administration

INTERNATIONAL CONFERENCE . February 26 - March 05, 2006, Moscow, Russia . ... Moscow State University . Institute of Mechanics of MSU . ... It follows the tradition of biannual confer-ences organized by the Institute of Mechanics of Moscow State University between 1976 and 2004 (see http://hit2003.narod.ru/ ), which were widely attended by scientists and students from the former Soviet Union. ... Phone, E-mail and Fax. ... Institute of Mechanics, Moscow State University . ...

Еще в разделе: (Показать все результаты (>31) - hit-conf.imec.msu.ru/ )

• Nonlinear Problems of Gydrodynamic Stability Theory
• Untitled

... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>17) - pk.math.msu.ru/ )

• information | Mechmath admission for internetional students
• About Mathematics and Mechanics Faculty | Mechmath admission for internetional

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

COMPUTER DESIGN OF HETEROCYCLIC RING-OPENING REACTIONS. ... Since the cleavage of ring bond requires appearance of new bond either between th e (endo) atoms of initial cycle, or between initial cycle and external (exo) group, the first case is treated as endoopening, and the another as exo-opening: Endo-Ring Opening Exo-Ring Opening © 1995 American Institute of Physics 75 7 758 Heterocyclic Ring-Opening Reactions General Methodology and Algorithms 1. ... RULE FOR ENDO-TYPE RJNG OPENING. ...

Еще в разделе: (Показать все результаты (>196) - www.chem.msu.ru/ )

• Семинар "Перспективные наноматериалы"
• Лаборатория химии поверхности - ПУБЛИКАЦИИ ПОСЛЕДНИХ ЛЕТ
• Dmitriy Mendeleev Online

... Irakli Sikharulidze . ... Admitted to the Moscow State University, Department of Physics . ... Admitted to the Russian-German Institute of Science and Culture (RGI) . 1998. B.S. from Moscow State University (physics of polymers) . Since 1998. MS course at the Moscow State University, Department of Physics, Chair of Polymer and Crystal Physics (Head Professor Alexei R. Khokhlov) . 1999. ... Group Physics of Macromolecules (Head Professor J?rgen P. Rabe) . ... I. Sikharulidze. ...

Еще в разделе: (Показать все результаты (>124) - www.spm.genebee.msu.ru/ )

• Evgeny Menshikov
• Igor Yaminsky's homepage
• Kolesov's homepage

... MSU Chamber Orchestra . Concerts of . ... 1999/2000 season: . MOSCOW . ... German Music of XVII c. Johann ROSENMULLER (1620 - 1684) . ... Leontyevsky pereulok, 6 (metro station "Arbatskaya" or "Pushkinskaya") . ... MSU Chamber orchestra . ... Ulitsa Fadeeva, 4 (metro station "Mayakovskaya") . ... Big Hall of Moscow State University (the building at Vorobievy Gory) . ... MSU CHAMBER ORCHESTRA . ... The tickets are in the Moscow State Philarmony office . ... Big Hall of Moscow State University . ...

Еще в разделе: (Показать все результаты (>6) - music.genebee.msu.su/ )

• MSU Chamber Orchestra. Concerts. Season 2001/2002.
• MSU Chamber Orchestra. Concerts. Season 2000/2001.

Russian version . ... Leninskie Gory 1, Moscow, 119991, Russia . ... The title is: "The development of resonant X-ray reflectivity method near the L2,3 absorption edges for investigations of magnetic multilayers". ... Moscow. ... Russia. ... A. Smekhova, е.ю. Gan'shina, B.S. Roschin, A.D. Gribova, M.A. Andreeva, F. Wilhelm, A. Rogalev, "Structural and Magnetic Studies of [Co 0.45 Fe 0.45 Zr 0.1 /a-Si] N Multilayers", Journal of Spintronics and Magnetic Nanomaterials, 1 (1), pp.11-17 (2012) [pdf] . ...

Еще в разделе: (Показать все результаты (>34) - magn.phys.msu.ru/ )

• Collaboration
• DETI.2 : joint HZDR - RFBR project
• Сотрудники кафедры магнетизма: Ведяев Анатолий Владимирович

... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...

Еще в разделе: (Показать все результаты (>3) - lib.sinp.msu.ru/ )

... Biological Faculty . Moscow State Lomonosov University . ... EDUCATION : B.S. Lomonosov Moscow State University, 1971 Physics . M.S. Lomonosov Moscow State University, 1972 Biophysics . Ph.D. Lomonosov Moscow State University, 1978 Biophysics . ... Lomonosov Moscow State University, 1990 Biophysics . ... 1972-1978 Research assistant Lomonosov State University, Moscow . ... Mathematical modelling in biology, . ... Lecturer at Biological Faculty, Lomonosov State University, Moscow . ...

Еще в разделе: (Показать все результаты (>8) - biophys.msu.ru/ )

• C U R R I C U L U M V I T A E

... ВШБ МГУ - школе . ... В газете The Northeastern Voice (Northeastern University) вышла статья про стажировку студентов Высшей школы бизнеса МГУ в Бостоне. ... Puffer and McCarthy, who have worked for years with Moscow State University faculty, said MSU professor Alexander Naumov who has also taught at Northeastern, and who coauthored a book with Puffer proposed the program earlier in the year. ...

Еще в разделе: (Показать все результаты (>294) - www.mgubs.ru/ )

• Высшая школа бизнеса МГУ им. Ломоносова
• Профессор американского университета Бентли проведет курс 'Международный

ELENA ROVENSKAYA RUSSIAN . ... Optimization and optimal control, dynamic systems, mathematical modeling in economics and ecology . ... Elena Rovenskaya's research aims at the theoretical elaboration of new methods for solving optimal control problems (both analytical and numerical), as well as at application of existing methods to solve economic, social and ecological problems. ... 2009) Rovenskaya E.A. To the Solution of an Optimal Control Problem with State Constraints by Doubled-variations Method. ...

Еще в разделе: (Показать все результаты (>8) - oc.cs.msu.ru/ )

• CURRICULUM VITAE
• СПИСОК ПУБЛИКАЦИЙ Ровенской Е.А.

Портал | ... Первая десятка "Русского переплета" Темы дня: . ... УРАНИЯ . Научно-популярный образовательный журнал в "Русском переплете" . ... Как читать "Уранию" . ... Владимир Липунов . ... Сергей Пашутин . Феномены биологичекой эволюции Урания, популярно о сложном, 08.IV.2002 . ... Наука в "Русском переплете" Все проекты . ... Образование в "Русском переплете" Все проекты . ... Дата создания журнала: 7 декабря 2000 г. Обратите внимание на баннерную систему и счетчик Русского Переплета . ...

Еще в разделе: (Показать все результаты (>182) - www.pereplet.ru/ )

• Journal Impact Factors
• The Avalon Project : Treaty concerning the Cession of the Russian Possessions

. [Russian] .. Education, . Research Interest . Scientific Achievements . My Teachers . Parachute Science . Parachute Equipment . Margarita Dzhalalova . Ph.D. (Phys.& Math.), Senior Research Scientist . Address: . Institute of Mechanics . M.V. Lomonosov Moscow State University . 1 Michurinsky pr. Moscow 119192, Russia . E-mail: . margarita-vd@mail.ru . Copyright & Design 2001 by M. Dzhalalova . М.B. Джалалова

Еще в разделе: (Показать все результаты (>9) - margaret.imec.msu.ru/ )

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>3) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.