... Faculty of Physics . ... MSU Physicists (Prof. V.S. Chernysh, Dr. A.E. Ieshkin, Faculty of Physics, and Senior Researcher Yu.A. Ermakov, Scobeltsyn Nuclear Physics Research Institute, MSU) discovered a new mechanism of sputtering with cluster ion beams. A cluster is an assembly of atoms or molecules which quantity is in range from a few up to a few tens of thousands units per cluster. ... Recent decades, interaction of cluster ions with solids has been under extensive investigation. ...

Еще в разделе: (Показать все результаты (>327) - phys.msu.ru/ )

• Физический факультет МГУ им. М. В. Ломоносова

Sign in Register . ... Resources . ... Forums . ... 495) 3334-65-56 . info@ecfs.msu.ru . All contacts . ... Home Forum . ... Search in section Everywhere Основная дискуссия -Ongoing consultations/ Текущие онлайн конференции -Прошедшие онлайн конференции -Общая дискуссия -Евразийское почвенное партнерство . ... Основная дискуссия . Ongoing consultations/ Текущие онлайн конференции . ... Прошедшие онлайн конференции . ... Общая дискуссия . ... The Department of land resources . ... Forum . ...

Еще в разделе: (Показать все результаты (>46) - ecfs.msu.ru/ )

• Ongoing consultations/ Текущие онлайн конференции | ECFS
• Draft Plan of Action for Eurasian Subregional Partnership | ECFS

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>5) - sinp.msu.ru/ )

... Alexei Lidov.. ... The creation of sacred space as a form of creativity and subject of cultural history .. ... 91 Mikhail V. Bibikov Byzantine Eden: "time in space" .. ... 140 Svetlana Popovi The Byzantine Monastery: its Spatial Iconography and the Question of Sacredness .. ... 525 762 Milena Rozhdestvenskaya The Creation of Sacred Space in Medieval Russian Literature: apocrypha and chronicles .. ... 556 Vladimir V. Sedov The Sacred Space of the Medieval Russian Church: the Architectural Aspect .. ...

Еще в разделе: (Показать все результаты (>20) - imk.msu.ru/ )

• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/Hieroglyphs.pdf
• Институт мировой культуры МГУ

... Keywords: anthropology, craniotrigonometry, skull angular morphometry, the Russian Imperial Romanov family, shaping angles parameters Sviridov A.A. Cranial study of population of Loyalty Islands (Melanesia) (p. 88) The aim of this work is to study cranial series of 67 skulls from the Loyalty Islands (Northern Melanesia), stored at Musee de l'Homme (Paris, France). ... The study of intragroup variability showed a difference in the cranial types of the population of the Lifou and Mare islands. ...

Еще в разделе: (Показать все результаты (>26) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2014_1.doc
• http://www.antropos.msu.ru/vestnic/e2013_1.doc
• http://www.antropos.msu.ru/vestnic/e2013_4.doc

The Laboratory of the Historical Information Science . ... The historical information science laboratory was founded within the structure of the source studies department on 8 December 1995 for the purpose of fulfilling the decision of the academic council of the History Faculty of 4 October 1991 about the transformation of a group for the application of mathematic methods and mainframes in historical research in the laboratory of historical information sciences. ... Senior laboratory assistant (2) . ...

Еще в разделе: (Показать все результаты (>4348) - www.hist.msu.ru/ )

• ЭОС истфака МГУ: Кафедра исторической информатики
• ЭОС истфака МГУ: Course categories
• Электронная образовательная среда исторического факультета МГУ имени

HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...

Еще в разделе: (Показать все результаты (>35) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/literature/WOS.pdf

. Faculty of Mechanics and Mathematics, . M.V. Lomonosov Moscow State University . This site is created and supported by . the A.M. Liapunov French-Russian Institute . of Moscow State University .

Еще в разделе: (Показать все результаты (>184) - new.math.msu.su/ )

• Scientific directions | Department: General Problems of Control. Faculty of
• Mikhail Ilych Zelikin | Department: General Problems of Control. Faculty of
• Department of Probability Theory

... about ERC . education . research . ... The Lomonosov Moscow State University (MSU) has been training specialists in nanotechnology, nanomaterials and nanosystems for nearly ten years . ... MSU Nanotechnology Education and Research Center (ERC) was established to consolidate efforts of MSU units aimed at research and development and true cross-disciplinary education in nanotechnology, nanomaterials and nanosystems. ... Fundamentals of Nanotechnology? was the first step in ERC?s activity. ...

Еще в разделе: (Показать все результаты (>32) - nano.msu.ru/ )

• Events | MSU Nanotechnology Education and Research Center

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Magnetospheric particles and radiation conditions . ... Scientific equipment . ... ELFIN-L . ... It consist of a Flux Gate Magnetometer (FGM), an Energetic Particle Detector for Electrons (EPDE), and an Energetic Proton Detector for Ions (EPDI). ... Energetic particles create a hazardous environment for satellites and humans in space and cause a number of satellite failures. ... Magnetospheric particles and radiation environment . ...

Еще в разделе: (Показать все результаты (>54) - lomonosov.sinp.msu.ru/ )

• DEPRON | Университетский спутник "Ломоносов"
• ShOK | Университетский спутник "Ломоносов"
• TUS | Университетский спутник "Ломоносов"

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>285) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

Chemistry of Heterocyclic Compounds, Vol. ... 8, 1995 INSTRUCTIONAL TECHNIQUE IN HETEROCYCLIC CHEMISTRY COMPUTER ANIMATION: A NEW METHOD AND REPRESENTATION IN HETEROCYCLIC FOR TEACHING, OF KNOWLEDGE COMMUNICATION, ABOUT REACTIONS CHEMISTRY E. V. Babaev We propose the use of computer animation techniques .for representation of knowledge about organic reactions, in particular as applied to syntheses and transformations of heterocTcles. ... Let us briefly consider the capabilities of this program. ...

Еще в разделе: (Показать все результаты (>196) - www.chem.msu.ru/ )

• THE ALTERNATION RULE: AN OLD HEURISTIC PRINCIPLE OR A NEW CONSERVATION LAW
• THE EFFECT OF CATALYST ON COMPOSITION OF ETHYLENE/1-HEXENE COPOLYMERS

... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>60) - acoustics.phys.msu.ru/ )

Школа танцев Грация-МГУ . ... Грация-МГУ::Форум Общение Общение . ... Вестник тирании . ... O'Rey . Apr 20 2012, 04:15 . Сообщение #1 . born to create drama . Астрологи объявили неделю кровавой тирании. ... Любой пользователь, упомянувший в течение Недели Кровавой Тирании анатомические особенности строения женского тела, будет забанен на хренадцать дней и обретет статус-сообщение 'Похотливая самка бабуина'. ... Цитата(O'Rey @ Apr 20 2012, 05:29) . ...

Еще в разделе: (Показать все результаты (>931) - grace.msu.ru/ )

• Плохой день - Грация-МГУ::Форум
• Вся правда про белку - Грация-МГУ::Форум
• Нормы не для нас - Грация-МГУ::Форум

... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>4) - www.edst.msu.ru/ )

• http://www.edst.msu.ru/conf/docs/Bologne.doc

... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...

160. Department of General Physics and magneto-ordered matter. Physics Department of