... Third International Symposium UNIVERSAT-2009: UNIVERSITY SATELLITES IN SPACE SCIENCES EDUCATION is canceled . ... With great regret we have to inform you that the Third International Symposium UNIVERSAT-2009: UNIVERSITY SATELLITES IN SPACE SCIENCES EDUCATION scheduled to take place 28 September, 2009 - 4 October, 2009 in Moscow, Russia, has been canceled by the Organizing Committee. ... On behalf of UNIVERSAT-2009 Organizing Committee, . ...

Еще в разделе: (Показать все результаты (>62) - cosmos.msu.ru/ )

• University Satellites and Space Science Education '2006

... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 29/09/2015 . ... Natural resousces management? The purpose of the "Natural resources management" Master?s Degree programme is to educate specialists in the field of natural resource management, environmental management, sustainable development of regions and densely urbanized territories. ...

Еще в разделе: (Показать все результаты (>6) - www.hsib.msu.ru/ )

• General information | Высшая школа инновационного бизнеса МГУ

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>20) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Проект Ломоносов . ... М.В. Ломоносов . ... Это будет более крупным космическим проектом МГУ по сравнению с предыдущими спутниками ?Татьяна? и ?Татьяна-2?. ... МГУ носит имя М.В.Ломоносова . Поэтому имя М.В.Ломоносова ?на борту? спутника ? ... Зарисовка из книги М.В. Ломоносова. Запуск спутника ?Михайло Ломоносов? безусловно внесет значительный вклад в развитие человеческого знания в область физики, исследования которые начал еще М.В. Ломоносов (исследования природы молний и т.д.). ...

Еще в разделе: (Показать все результаты (>26) - lomonosov.sinp.msu.ru/ )

• BDRG | Университетский спутник "Ломоносов"
• Lost Password | Университетский спутник "Ломоносов"
• Программа эксперимента | Университетский спутник "Ломоносов"

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>93) - electr003.chem.msu.ru/ )

\ddot x + x = u

Еще в разделе: (Показать все результаты (>12) - ldis-sl.cs.msu.ru/ )

... Web Extension to American Psychological Association Style (WEAPAS) (Rev. 1.4.3) [WWW document]. URL http://www.beadsland.com/weapas/ . Этот документ содержит дополнения к Приложению 3-A (Appendix 3-A, APA, 1994 , pp. 189-222) и использует стандарт Интернет касающийся унифицированных локаторов ресурсов (URL) ( Graham, 1995 ), используемый на World Wide Web (WWW или Web) ( W3C, 1995 ). ... Желающие использовать библиографический стиль MLA могут обратиться к Walker ( 1995 ) и Wainwright ( 1995 ). ...

Еще в разделе: (Показать все результаты (>18) - psyberlink.flogiston.ru/ )

• Serge Moscovici. Social Representations Theory and Social Constructionism

... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>5) - physcontrol.phys.msu.ru/ )

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...

Еще в разделе: (Показать все результаты (>3) - ocl.sai.msu.ru/ )

• SAI OCL Catalog The Team
• SAI Open Star Clusters (SAI OCL) Catalog

... Более того, представитель компании Applied Space Resources (ASR), говорит о сроке в пять лет, по прошествии которого будет совершен первый полет к спутнику Земли . ... Директор Общества Артемиды (Artemis Society International - ASI), Ян Рендал Строк (Ian Randal Strock), уверен, что у правительств сейчас нет мотивов для возвращения в космос, они есть у частного капитала. ASI участвует в создании проекта коммерческой обитаемой лунной базы и планирует совершить первый полет в течение десяти лет. ...

Еще в разделе: (Показать все результаты (>356) - www.nature.web.ru/ )

• Theoretical Computer Science: взгляд математика
• В плену у совершенства

... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...

Еще в разделе: (Показать все результаты (>10) - ccoe.msu.ru/ )

... Carbon and Nitrogen As Resources Limiting the Growth of Mono- and Mixed Cultures of Pseudomonas aeruginosa Dissociants P. V. Fursovaa, E. S. Mil'kob, and A. P. Levichc c Department of Biophysics Department of Microbiology Department of General Ecology, Moscow State University, Moscow, 119991 Russia e-mail: fursova @biophys.msu.ru b a Received December 26, 2006 Abstract--New experiments for detection of resources limiting the ... 1997; Levich, 2000). ... 1) (Levich et al., ...

Еще в разделе: (Показать все результаты (>13) - dis.bio.msu.ru/ )

... General Catalog of Variable Stars (GCVS database, Version 2012 Feb.) ... The cross-identification tables of the General Catalogue of Variable Stars (GCVS) contain all GCVS (including extragalactic variables from vol.V), NSV (New catalogue of Suspected Variable stars) and Supplement to the NSV stars as well as stars from the name-lists of variable stars nos. 67 - 80; it also makes it possible to find out identifications between the GCVS and the NSV catalogue. ... I-III) names are included. ...

Еще в разделе: (Показать все результаты (>100) - sai.msu.ru/ )

• Конференции сайта АстрО
• General Catalogue of Variable Stars: Description

Mathematical modeling of biophysical processes in living cells and tissues . duration 6 months . ... 7(095) 939-26-12, Fax: +7(095)939-31-13, Email: romanov@yumr.phys.msu.ru . ... Interaction of femtosecond laser pulses with plasmas of modified targets . ... Theoretical investigations of polarization self-action and wave-interaction effects in nonlinear optics. ... Alexander V. Priezzhev, Associate Professor, Candidate of Sciences (physics and mathematics), Tel. ...

Еще в разделе: (Показать все результаты (>33) - foroff.phys.msu.ru/ )

• Key research directions
• Admission Regulation
• The Faculty System of Education

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>60) - mph.cmc.msu.ru/ )

. Совещание 'Солнечные космические лучи: чему нас учат солнечные циклы', Дубна, 13.02.15 . С 13 по14 февраля 2015 г. в филиале НИИЯФ МГУ (г. Дубна) проходит рабочее совещание 'Солнечные космические лучи: чему нас учат солнечные циклы'. Начало заседания 13.02.2015 в 11.00, аудитория им. Д.И.Блохинцева. Программа мероприятия размещена здесь: hep.msu.dubna.ru/main/mod/resource/view.php?id=1260 .

Еще в разделе: (Показать все результаты (>30) - www.msu.dubna.ru/ )

• MSU @ Dubna - Семинар "Полярные сияния: их прошлое и будущее, на Земле и далеко
• MSU @ Dubna - Учебная практика по медицинской физике студентов физического
• MSU @ Dubna - II чемпионат проекта "CanSat в России", 01.07.2013, Дубна

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>6) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

Academic English English for Students of Mathematics and Mechanics Supplementary Exercises Part II L.N.Vygonskaya O.Y.Sviridenko MSU Moscow 2012 Academic English (part 2 of 4) The tasks are based on «English for Students of Mathematics and Mechanics» by Y.I. Mindeli. Unit 1 Task 18. ... 1 Armer, T. Cambridge English for Scientists, Cambridge, 2011 4 Academic English (part 2 of 4) Unit 7 Midterm test Unit 8 (At home) Make up a list of linking words you know and bring it to class. ... Task 15 p.93. ...

Еще в разделе: (Показать все результаты (>28) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/plan.pdf
• http://www.eng.math.msu.su/download/Academic_English_4.pdf
• http://www.eng.math.msu.su/download/Notice_2013.pdf

... Chair of Computer Methods of Physics . Department of Physics, M.V. Lomonosov Moscow State University . Create new account . ... Request new password . Username * . Enter your Chair of Computer Methods of Physics username. Password * . Enter the password that accompanies your username. ... Department of Physics M.V. Lomonosov Moscow State University , Chair of Computer Methods of Physics , 2014 . ... Let us know ! ...

Еще в разделе: (Показать все результаты (>6) - cmp.phys.msu.ru/ )

• Contacts | Chair of Computer Methods of Physics
• Welcome! | Chair of Computer Methods of Physics
• Добро пожаловать! | Кафедра математического моделирования и информатики

... Seminar archive . ... The structure of the X-ray sources in the hard spectral state of accreting black-hole binaries has been a subject of intense debate. The paradigm dominant for many years postulated that the accretion disc in the hard state is truncated at some radius >> the innermost stable orbit (ISCO) whereas the disc reaches the ISCO in the soft state. ... On the other hand, there have been numerous claims in recent years that the disc extends to the ISCO in the hard state. ...

Еще в разделе: (Показать все результаты (>18) - master.sai.msu.ru/ )

• SAI Space Monitoring Laboratory