Особенности загрязнения земель предприятиями нефтегазодобывающего комплекса Нижневартовского района . Features of land pollution by enterprises of oil-and-gas production complex in Nizhnevartovsk region. Ходжаева Г.К. // Нефтегазовое дело, 2011. ... В данной статье приводится зонирование территории Нижневартовского региона по площади и объему нефтяного загрязнения после аварий. URL: http://www.ogbus.ru/authors/Khodzhaeva/Khodzhaeva_1.pdf . ...

Еще в разделе: (Показать все результаты (>10) - ecoinformatica.srcc.msu.ru/ )

... ECFCD1D8-1F04-4979-9E2D-6A83A664749A} vti_backlinkinfo:VX| vti_editor:SW| FrontPage Frames Wizard vti_nexttolasttimemodified:TW|08 Dec 2003 22:08:57 - 0000 vti_cacheddtm:TX|25 Nov 2003 17:15:32 - 0000 vti_filesize:IR|679 vti_cachedtitle:SR|Home vti_cachedbodystyle:SR| vti_cachedlinkinfo:VX|F|_ private / Content.htm F|_ private /Statistic.htm vti_cachedsvcrellinks:VX| FFUS |_ private / Content.htm FFUS |_ ...

Еще в разделе: (Показать все результаты (>66) - genphys.phys.msu.su/ )

• http://genphys.phys.msu.su/rus/lab/mol/234/_vti_cnf/experiment.htm
• http://genphys.phys.msu.su/rus/lab/mol/234/_vti_cnf/index.htm
• http://genphys.phys.msu.su/rus/lab/mol/234/_vti_cnf/literature.htm

... Host City . ... Aug 31, 10.00 Excursion to Dmitrov . Excursion to Dmitrov Visit the ancient Russian town of Dmitrov and shake hands with Yuri Dolgoruki, a medieval Russian prince, who incidentally happens to be also the founder of the city of Moscow. Dmitrov known as the Moscow's Nohern pearl is just 65 kilometers north of Moscow on the suburban road. ... Dmitrov finally entered the Moscow county in the 16th century, after a lengthy internal struggle among its princes. ...

Еще в разделе: (Показать все результаты (>12) - www.elch.chem.msu.ru/ )

• Laboratory of Electrical Double Layer and Electrode Kinetics

Q: Recently I read a book called ?C14-CrashЃ by Christian Bloess and Hans-Ulrich Niemitz (there is a summary in German with figures on . ... Briefly, the authors claim that the majority of the original assumptions made by Libby for the radiocarbon . ... directly calculated from a C14 value." ... such fractions are used for calibrations and dating. ... used for radiocarbon calibration. ... important after atmosphere reservoir - upper ocean. ... radiocarbon content in the atmosphere. ...

Еще в разделе: (Показать все результаты (>81) - hbar.phys.msu.ru/ )

• R. R. Newton, "Two uses of ancient astronomy"

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>4) - srd.sinp.msu.ru/ )

... In Chap. ... sign cos : By the theorem on the motion of the center of masses in the space in projections to the related axes .x ; y ; z/ and the theorem on the change of the kinematic moment with respect to these axes, we obtain the following complete system of differential equations in the dynamical quasi-velocity space R1 fvg S2 f; g C R3 fx ;y ;z g: v cos P v sin C y v sin sin P 2 2 z v sin cos C .y C z / D Fx =m; v sin cos C v cos ... I2 n0 d cos with variable coefficient....

Еще в разделе: (Показать все результаты (>34) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-185-2.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• ConClus
• Nhunt: program for nucleic acid sequence similarity search

... In their previous pap ers, the authors of this study have suggested and realized a method of simultaneous determination of temp erature and salinity of seawater using laser Raman sp ectroscopy, with the help of neural networks. ... This pap er presents comparison of various input data compression methods using feature selection and feature extraction and their effect on the error of determination of temp erature and salinity. ... Walrafen, G.E.: Raman Sp ectral Studies of Water Structure. ...

Еще в разделе: (Показать все результаты (>25) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/en/articles/2014/Application.pdf
• http://rswater.phys.msu.ru/en/articles/2014/Kohonen.pdf
• http://rswater.phys.msu.ru/Assets/Water/OMNN_2010.pdf

... Time calculated from Fermi GBM Trigger Time = 14:12:08.67 ( Connaughton, GCN 9230 ). 1% coincident with our start zero image time. 3x3 degrees around Swift XRT position . ... SUBJECT: GRB 090424 : MASTER-Net prompt optical limit DATE: 09/04/25 20:29:42 GMT FROM: Vladimir Lipunov at Moscow State U/Krylov Obs E. Gorbovskoy, V. Lipunov, V.Kornilov, A.Belinski ... Our observations results: ---------------------------------------------------------------------- Fermi GRB Trigg.* ...

Еще в разделе: (Показать все результаты (>19) - observ.pereplet.ru/ )

Бейсбольная команда Государственного университета штата Нью-Йорк (СУНИ) возвращается в Россию . State University of New York Baseball Returns to Russia . ... СУНИ гордится своим университетским партнерством, старейшим как для США, так и для России. С целью развития и распространения студенческих обменов, научных исследований и прочих инициатив в области высшего образования между СУНИ и МГУ три года тому назад в Олбани был открыт Центр по России и Соединенным Штатам. ... мгу-суни . ...

Еще в разделе: (Показать все результаты (>16) - suny.msu.ru/ )

• Центр по делам России и США :: Публикации
• Center on Russia and the United States :: Summary of SUNY/MSU Center Activities

... Education: Ph.D. in physics, Moscow State University, 1996, . ... 1998 - present time Research fellow at Moscow State University . ... 1996 - 1998 Junior research fellow at Moscow State University . ... February 1995 - April 1995 Visitor at Dept. of Solid State physics of Catholic University of Nijmegen, The Netherlands . ... 2002 Stipendia for young educators and young scientists of Moscow State University . ... Dept. of Physics, Moscow State University, 119992 Vorob'evy Gory, Moscow, Russia . ...

Еще в разделе: (Показать все результаты (>25) - shg.phys.msu.ru/ )

• Intro

... кафедра высшей геометрии и топологии . ... Т.Е.Панов ведет лекции и семинары по аналитической геометрии, линейной алгебре, классической дифференциальной геометрии, дифференциальной геометрии и топологии. ... Текстовая версия (pdf) . Victor M. Buchstaber and Taras E. Panov. ... Т.Е.Панов. ... Математические заметки 63 (1998), вып.2, стр.260-268. ps ; английский перевод: arXiv: math.AT/9908166 . ... Успехи мат. наук 59 (2004), вып.3, стр.159-160. pdf ; английский перевод: arXiv: math.AT/0407189 . ...

Еще в разделе: (Показать все результаты (>117) - higeom.math.msu.su/ )

• Research (Russian)
• Toric Topology (English)

... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...

154. http://www.iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf

155. atmos 3.0 page

156. Phenolic Resins: Chemistry, Applications, Standardization, Safety, and Ecology.

157. Лаборатория химии и физики полупроводниковых и сенсорных

158. http://beams.chem.msu.ru/doc/JCPSA613314144101_1.pdf

159. extra:main [CompHEP]

160. http://qi.phys.msu.ru/papers/2010-nphoton-4-585.pdf