... Contact information . ... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty . ... Our goal is to provide researchers from many branches of science, education and industry with innovative tools and methods for solving applied problems using the latest information technologies, modern methods of computation modeling and scientific visualization. ... The uncertainty can be used in further uncertainty estimation of a computational model that uses FetchClimate. ...

Еще в разделе: (Показать все результаты (>70) - en.cs.msu.ru/ )

• Research Laboratory of Computational Modeling Tools

О КАФЕДРЕ . ... Трухин В. И. Жиляева В.А. Жиляева А. И. Петрунин Г. И. Список публикаций ћСписок статей . ... Бобров А. В., Жиляева А. И. Минеральные ассоциации включений в гранатах из кимберлитовых трубок Мир и Сытыканская (Якутия) //Вестник НСО. ... A. Zhilyaeva, L. Leonyuk, G.-J. Babonas, G. Bocelli, S. Demishev, N. Leonyuk, V. Maltsev, A. Reza. ... Трухин В.И., Жиляева В.А., Жиляева А.И. Вязкая намагниченность (VRM) базальтов тройственного сочленения Буве (Южная Атлантика) // Физика Земли. ...

Еще в разделе: (Показать все результаты (>2) - geo.phys.msu.ru/ )

... Предыдущее сообщение: PARALLEL.RU - Новости, выпуск #263 [14/04/2009] . ... НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / news / + NVIDIA предоставляет пользователям OpenCL Driver. http ://www.nvidia.com/object/io_1240224603372.html + Psychsoftpc выпускает Psychlone Tesla Personal Supercomputer. http ://www.psychsoftpc.com/psychlone_tesla.htm + NSF финансирует участие 14 университетов в программе IBM/Google Cloud Computing University Initiative. http ://www.nsf.gov/ news...

Еще в разделе: (Показать все результаты (>16) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #261 [18/03/2009]
• PARALLEL.RU - Новости, выпуск #266 [27/05/2009]

... Microstructure deeply influences the properties and thus the functionality of a material. In an X-ray diffraction pattern, the microstructure information is usually extracted from the breadth and shape of line profiles. ... Доклад ?Structure/microstructure and their interplay in nanomaterials and layered systems? оказался очень полезным и интересным для ученых, работающих в области неорганического синтеза и физико-химических методов исследования. ...

Еще в разделе: (Показать все результаты (>2) - nano.msu.ru/ )

On this page you will find a list of images of SN 1998bp which was found in NGC 6495 . ... M1 supernova search has a 1998bp page New 1/8/99 . M.Armstrong discovery image 4/29/98 . ... Spectroscopy has performed by ESO group and Harvard group: they report that SN 1998bp is of type Ia around the maximum, but peculiar. ... 3127 (A.Ap.Suppl, 113, 151 (1995)) ESO group 4500 These three indicate that NGC 6495 is not so near as Virgo cluster; it looks like about three or four times further than Virgo. ...

Еще в разделе: (Показать все результаты (>27) - www.rochesterastronomy.org/ )

• Supernova 2002bl in UGC 5499
• Supernova 1998S in NGC 3877
• Supernova 1999an in IC 755

... Study of the Russian " Silver Age " neology . ... Dictionaries of neologisms constitute an important part of lexicography. ... The peculiarity of our project is the full scope of text (at least published) considered and uniformity of description: dictionary entries of all the authors’ neologisms have the same format (suggested for Khlebnikov’s neology). ... Khlebnikov's neology (N. N. Pertsova). In 1995 "The Dictionary of Khlebnikov's Neologisms" was published. ...

Еще в разделе: (Показать все результаты (>19) - lcl.srcc.msu.ru/ )

Adsorption of Humic Substances onto Kaolin Clay Related to Their Structural Features Gerd U. Balcke,* Natalia A. Kulikova, Sebastian Hesse, Frank-Dieter Kopinke, Irina V. Perminova, and Fritz H. Frimmel ABSTRACT Eleven well characterized humic substances (HSs) were adsorbed from aqueous solution onto a Na-kaolin clay. ... ADSORPTION OF HUMIC SUBSTANCES ONTO KAOLIN CLAY 1809 Fig. ... Weight averaged molecular weights (MWs) of humic substance (HS) before and after adsorption onto Na-kaolin clay. ...

Еще в разделе: (Показать все результаты (>75) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2009/2009-kulikova-uptake.pdf
• http://www.mgumus.chem.msu.ru/ihss-14/docs/IHSS-08-Proc-vol-03.pdf
• http://www.mgumus.chem.msu.ru/publication/2010/2010-kulikova-estimation.pdf

Russian . Selected publications of V. Zakharov 2015 . Zakharov V.S., Perchuk A.L., Zavyalov S.P., Sineva T.A., Gerya T.V. Supercomputer Simulation of Continental Collisions in Precambrian: The Effect of Lithosphere Thickness // Moscow University Geology Bulletin. ... P. 77–83. doi: 10.3103/S014587521502012X. Paper (pdf) . ... Paper (pdf) . ... Summary in English . ... DOI: 10.3103/S014587521101011X. Paper (pdf) . ... Paper (pdf) Summary in English . ... Page design: ©V.Zakharov . ...

Еще в разделе: (Показать все результаты (>18) - dynamo.geol.msu.ru/ )

• Summaries of articles
• V.Zakharov's Ph.D. thesis

... кафедра ПЕТРОЛОГИИ . ... Aksyuk A.M., Fedkin A.V., Seltmann R. Micas from granites of the Orlovka and Etyka tantalum deposits and estimations of HF concentrations in endogenic fluids. ... Seltmann R., Aksyuk A.A., Fedkin A.V., and Zaraisky G.P. Geochemical evolution trends characterizing pegmatite-aplite and line rock formation related to Li-F granites in the Orlovka and Etyka tantalum deposits, Eastern Transbaikalia, Russia. ... 1998, Vol.10, p. 271. ... Toronto, 1998, p. A148. ...

Еще в разделе: (Показать все результаты (>61) - www.geol.msu.ru/ )

... Using Ar clusters accelerated by 30 kV, with a dose of ° ° 6 · 1014 e cmю2, we have effectively removed an asperity that was 3500 A wide and 350 A high. Subsequent processing ° ° with 5 kV acceleration reduced the surface roughness from an Ra value of 13.2 A to 4.8 A. This demonstrates the effectiveness of GCIB for reducing sub-micron roughness to atom level smoothness. с 2005 Elsevier B.V. All rights reserved. ... Technique and results Fig. 1 shows schematically the GCIB beamline [2]. ... Fig. ...

Еще в разделе: (Показать все результаты (>53) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LIIWM/JPhysB33_2000_5045Khodyrev.pdf
• http://danp.sinp.msu.ru/LIIWM/PhysRevA64_2001_023201NMKab.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb_GCIB_processing_Swenson.pdf

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>24) - www.msm.biophys.msu.ru/ )

• Transport and Maps

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• ConClus

... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...

Еще в разделе: (Показать все результаты (>3) - physelec.phys.msu.ru/ )

• http://physelec.phys.msu.ru/staff/zykovapubl.doc

... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....

Еще в разделе: (Показать все результаты (>2) - mouse.belozersky.msu.ru/ )

... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...

Еще в разделе: (Показать все результаты (>3) - siberian-lang.srcc.msu.ru/ )

... The "diagrams of minimum expected tsunami arrival time" are shown for 25 coastal sites; the TWS dead zones for each of these sites are distinguished by more frequent isolines (every 1 min). ... I ( is the site name). ... We presented isolines of minimum expected tsunami time for all these sites. ... However, there are also sites, In every such case the minimum expected tsunami time tmin has to be to the minimum tsunami propagation time at the distance R in the direction to the respective settlement....

Еще в разделе: (Показать все результаты (>17) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E19_Puspito.pdf
• http://seac47-2.phys.msu.ru/proc/E02_Cochran.pdf
• LOCAL TSUNAMI WARNING AND MITIGATION -- Proceedings Download Page

. Russian Version . Faculty of Computational Mathematics and Cybernetics . The Department of Operations Research . About Us . News . ORM2016: actual announcement and abstract templates . Archive of . Conferences ORM . Study . Undergraduates . Postgraduate education . Bachelor Program . Master Program . Faculty . Lecture . notes . Contacts . Graduates . New . publications . Create Date : 23.05.05 . The Department of Operations Research

Еще в разделе: (Показать все результаты (>5) - io.cmc.msu.ru/ )

... Korystov, S. P. Kulik, and A. N. Penin Faculty of Physics, Moscow State University, Vorob'evy gory, Moscow, 119899 Russia Received February 8, 2001 The interference of spontaneous parametric radiation was observed from two nonlinear crystals separated by a macroscopic layer of a linear substance and excited by a common pump beam. In the presence of strong dielectric dispersion in the layer, the frequency­angular spectra display features analogous to the Rozhdestvenski hooks. ...

Еще в разделе: (Показать все результаты (>46) - qi.phys.msu.ru/ )

• Sergei Kulik: Scientific interest
• Publications :: Quantum Information Laboratory

... Выпускники . Выпускники ВМиК . Канада (+США) . Новости США и Канады . ... Женский клуб . ... Издательство МГУ . ... Новости для выпускников . МГУ им.Ломоносова . ... База данных выпускников . ... Выпускники МГУ . ... Дайв-Клуб МГУ . ...

Еще в разделе: (Показать все результаты (>160) - www.moscowuniversityclub.ru/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>4) - iconolat13.phys.msu.ru/ )

• Program overview