... COMPUTATIONAL . ... Scientific description and computerization of archives . Researchers of the Rare Books and Manuscripts Department of the Scientific Library of Moscow State University, the Orthodox Svyato - Tikhonovsky University and the Laboratory for Computational Lexicography are working on the scientific description of I. A. Ilyin?s personal archives. ... The conception of scientific description and computerization of archives was developed within the framework of this project. ...

Еще в разделе: (Показать все результаты (>15) - lcl.srcc.msu.ru/ )

... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. December 17, 1996 . Mariner's Mercury . ... Explanation: Mercury, the closest planet to the Sun, remains the most mysterious of the Solar System's inner planets. ... The only spacecraft to explore Mercury close-up was Mariner 10 which executed 3 flybys of Mercury in 1974 and 1975, surveying approximately 45 percent of its surface. ...

Еще в разделе: (Показать все результаты (>132) - www.arcetri.astro.it/ )

• APOD: December 6, 1999 - M83: The Southern Pinwheel Galaxy from VLT
• APOD: September 9, 1999 - Comet Hale Bopp Over the Superstition Mountains
• APOD: 2000 September 25 - AR 9169: A Large Sunspot

Title Author Key words Clinical perspective on social inequalities Masalkov I.K critical sociology, clinical approach, social pathology, paradoxical messages, schizophrenic behavior, fear, shame, anger Social inequality refers to relational processes in society. In article are considered specific features of the degradation of social relations in different areas. ... Economic approach considers features of the distribution of wealth and income. ... Abstract ...

Еще в разделе: (Показать все результаты (>66) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2014/4/15.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2015/2/04.pdf
• English version - Социологический факультет МГУ

THE FIRST JAPAN-RUSSIA MEDICAL FORUM PROGRAM Date: December 10, 2012 Venue : Intellectual Center - Fundamental Library of Lomonosov Moscow State University Bld.27, Lomonosovskiy prospect, Moscow , 119991, Russia Organizers: Lomonosov Moscow State University Tohoku University Supported by Embassy of ...

Еще в разделе: (Показать все результаты (>13) - fbm.msu.ru/ )

Society NewS AwArdS ANd PrizeS RAS Awards 2006 Each year the RAS recognizes outstanding achievement in astronomy and geophysics by the award of medals and prizes. ... He is a Fellow of the Royal Society (1985), an Honorary Doctor of Science at Wroclaw University in Poland (1994), a Foreign Member of the Norwegian Academy of Science (1996), an elected member of Academia Europa (2001). ... Jose Barros-Pinto, London. ... Magda Vasta, Dept of Physics & Astronomy, University College London. ...

Еще в разделе: (Показать все результаты (>95) - sai.msu.ru/ )

• General Catalogue of Variable Stars: What's new.
• Презентация PowerPoint

... A new method is proposed that makes it possible to determine the parameters of the three-dimensional (3D) multiwell potential of off-center atoms from extended X-ray absorption fine-structure (EXAFS) data. ... The parameters of the multiwell potential for Ge atoms in the Sn 1-x Ge x Te solid solution as functions of temperature and composition (77<T<300 K, x>0.4) were obtained in the classical approximation. ...

Еще в разделе: (Показать все результаты (>57) - scon155.phys.msu.su/ )

... Описание вакансии: . We seek a motivated and team-oriented individual who will be a key contributor to the overall success of BIND's chemistry program. ... Experience: . Polymer . ... Experience in synthesis of functional and biodegradable/biocompatible polymers. ... Familiarity with analytical methods for determination of polymer purity including gas chromatography, atomic absorption spectroscopy (ICP-OES/MS) and liquid chromatography (HPLC). ... Experience in peptide synthesis. ...

Еще в разделе: (Показать все результаты (>35) - www.chemport.ru/ )

• Phenolic Resins: Chemistry, Applications, Standardization, Safety, and Ecology.

... Make file etc. ... Model File 1 6 What is GRACE? ... Phys.Rev.D75, 113002('07) 15 GRACE for SUSY : Gauge Fixing Non-linear Gauge Fixing : S-leptons GF-S = 16 GRACE for SUSY : Renomarization Electro-weak corrections On-Mass-Shell scheme mass shifts for h0, H?, 0 2,3,4 only Sfermion sector 17 GRACE for SUSY : Renomarization QCD corrections 18 GRACE for SUSY : System Check Non-linear Gauge Check (One Phase Point) Ex. for One-Loop ~~ ~ ~~ ~ ~, , , , , , ) NLG Parameters : ( h H h H...

Еще в разделе: (Показать все результаты (>154) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks/GRACEV2.pdf
• http://qfthep.sinp.msu.ru/talks2013/fcnc_presentation.pdf
• http://qfthep.sinp.msu.ru/talks/popov.aa-qfthep2010.pdf

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>10) - iconolat13.phys.msu.ru/ )

• Proceedings

NATO Publishing Unit P.O. Box 17 3300 AA Dordrecht A U T H O R 'S D A T A B A S E E N T R Y S H E E T (to be submitted together with the scientific paper ) REFERENCE: ARW978587 TITLE OF THE NATO MEETING/ NATO ASI SERIES VOLUME : Use of Humic Substances to Remediate Polluted Environments: from Theory to Practice NAME OF THE DIRECTOR: Dr. Norbert ... The total space available for keywords and abstract of your paper is 900 characters (approx. 100 words). ...

Еще в разделе: (Показать все результаты (>135) - mgumus.chem.msu.ru/ )

• MGUMUS -- Current projects

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

... Почему передовые технологии программирования представляют особый особый интерес для "суперпрограммирования". Generative Programming - передовая технологии программирования, позволяющая совмещать небольшие накладные расходы на разработку программ и высокую производительность получаемого при этом программного кода. ... Generative programming объединяет в себе аспекты и подходы метапрограммирования, Generic programming, объектно-ориентированного программирования и Domain Engineering. ...

Еще в разделе: (Показать все результаты (>53) - new.math.msu.su/ )

• Department: General Problems of Control. Faculty of Mechanics and Mathematics.
• Extra courses of the department | Department: General Problems of Control.
• Geometric methods in optimal control theory | Department: General Problems of

All your comments please send to Yagola Anatoly ( yagola@prof.msu.ru ) or to web-deseigners of the site ( ill-posed@mail.ru , nataschka_@mail.ru ).

Еще в разделе: (Показать все результаты (>24) - foroff.phys.msu.ru/ )

. Загружено: Vovez . Дата загрузки: 05.03.2010 . Размер: 77.6 Кбайт . Подпись: no comments . Описание: ...

Еще в разделе: (Показать все результаты (>3) - www.dubinushka.ru/ )

- .. , . . , . (e-mail: soc@soc.pu.ru) , , , , - , knowledge, information, socio-economic approach, public welfare , , . "" " " - . , . This article is devoted to the socio-economic problem of definiteness of information and knowledge in modern society. Theoretical approaches to reveal the content of such categories as "knowledge" and "information" are analyzed. The special attention is devoted to an explanation of the key features of knowledge as public welfare.

Еще в разделе: (Показать все результаты (>63) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2010/1/02.pdf
• http://www.socio.msu.ru/vestnik/archive/2010/3/18.pdf
• http://www.socio.msu.ru/vestnik/archive/2012/4/08.pdf

Guide to Market Research and Analysis Canada Business Service Centres - CBSCs Last Verified: 2004-11-08 Document No. 4013 Summary Successful businesses have extensive knowledge about their customers and their competitors. ... Market Analysis Who is your customer? ... Product or service focus must be the customer. ... The information will assist in determining business size (output requirements), distribution channels, pricing, promotion strategy and other marketing decisions. ...

Еще в разделе: (Показать все результаты (>17) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc
• http://www.innovation.msu.ru/english/venturecapital.doc
• Start-Up Company Development :: Управление инновационной политики и организации

Programme of the International Congress Globalistics-2015 : Global Governance and Diplomacy in the Unstable World dedicated to the 70th anniversary of the UN and the Year of RUSSIA's Presidency ... 26th OCTOBER 09:3011:00 Registration of the participants of the International Scientific Congress Globalistics-2015 Venue : Intellectual Centre - Fundamental Library of Moscow State University, the 1st floor hall ... P-6 Address: Leninskie Gory, 1, b.51 (Metro "Universitet"). ...

Еще в разделе: (Показать все результаты (>1788) - fgp.msu.ru/ )

• featured post пєп?п? п?п?пе п?п?. п?.п?. п?пЎп?пЎпҐпЎя?пЎп?п°

... Do those millions of sites and services provide useful information, or are they just "information pollution"? ... Abstract This is a review of electrochemical information and services available on the internet, and some evaluation of their usefulness for professionals, students, and the general public. ... Two examples are the "Internetchemistry" site [26] and the "Electrochemical Science and Technology Information Resource (ESTIR)", which lists over 1,000 links to electrochemistry-related sites [7]...

Еще в разделе: (Показать все результаты (>68) - electr003.chem.msu.ru/ )

• Laboratory of Electrical Double Layer and Electrode Kinetics

. If you see this page, the nginx web server is successfully installed and working. Further configuration is required. For online documentation and support please refer to nginx.org . Commercial support is available at nginx.com . Thank you for using nginx.

140. Список слов, необходимых для сдачи экзамена по английскому