Title Author Key words Review of the monograph Yu.G. Volkova "Creativity: creativity against imitation" Dmitriev A.V. creative class, creativity, creative, imitation This article is reviewed monograph Yu.G. Volkova "Creativity: creativity against imitation" (2013). ...

Еще в разделе: (Показать все результаты (>38) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2011/2/05.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/2/11.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/4/17.pdf

.

Еще в разделе: (Показать все результаты (>59) - lav01.sinp.msu.ru/ )

... Take latest Pacman and install it : Create somewhere directory software/ and simply untar Pacman there : cd software wget http://physics.bu.edu/pacman/sample_cache/tarballs/pacman-latest.tar.gz tar xzf pacman-latest.tar.gz # It will be created, for example, directory pacman-3.21/ rm -f pacman-latest.tar.gz ln -s pacman-* pacman cd pacman source setup.csh # or setup.sh cd .. ... For instance, if you do pacman -allow tar-overwrite this setting remains as a default until you change it. ...

Еще в разделе: (Показать все результаты (>18) - lhe.sinp.msu.ru/ )

Вход в личный кабинет . ... Ярмарка вакансий и стажировок для студентов и выпускников вузов . Новости науки и техники События . ... Подписаться на новости . Вакансии . ... Компания: Nielsen company . The Nielsen Company is a market-leading information & media company with more than 41,000 employees in 100+ countries around the world. ... Please send your CV before June 9th marked in Subject line Summer Internship Program at: RussiaMoscow.HR@nielsen.com or info.russia@nielsen.com . ...

Еще в разделе: (Показать все результаты (>115) - www.physcareer.ru/ )

• Supply Network Operations- Supply Chain Manager-CS 00001567, компания Procter /
• HP Graduate Development Program 2010 / Вакансии / Physcareer.ru

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>4) - sinp.msu.ru/ )

... Форумы > Аспирантура > Тема . ... Форумы Список тем Новая тема . ... Аспирантура ин-т Макса Планка / ун-т Заарланда, Германия . ... http://flake.cs.uiuc.edu/~titov/ . ... http://www.mmci.uni-saarland.de/ . ... http://cs.uni-sb.de/ . ... http://www.mpi-inf.mpg.de/ . ... http://www.dfki.de . ... http://www.mpi-sws.org . ... http://www.coli.uni-saarland.de/ . ... http://www.saarbruecken.de/en/home . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>6559) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | MSc/PhD in Computer Science at Clemson
• MMOnline | Форумы | Разное | Работа в Microsoft
• MMOnline | Форумы | Аспирантура

... Главная Факультет политологии Новости факультета Новость . ... На заседании Ученого совета факультета политологии МГУ состоялось торжественное вручение сертификата призеру международного конкурса эссе на английском языке ?Creating the Future We Want?. Декан факультета политологии профессор А. Ю. Шутов поздравил студента III курса Павла Воробьева и вручил ему от имени организаторов конкурса сертификат за глубокое понимание и раскрытие темы. ... Поступление на факультет политологии в 2016 году . ...

Еще в разделе: (Показать все результаты (>8) - polit.msu.ru/ )

• Новости факультета

... ECOLOGICAL COOPERATION" . ... Brjanskaja oblast, Dubrovskij rajon, Seshcha (village), School . Brjanskaja oblast, Djat'kovskij rajon, Bytosh (village), School . ... Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Borodino (village), School . Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Yardenikha (village), School . ... Moscow, Children's Ecological Center of the National Park "Losinyj Ostrov" - the coordinator of ecological work of 18 Korolev-town's schools . Moscow, School #222 . ...

Еще в разделе: (Показать все результаты (>9) - www.ecocoop.ru/ )

... Working channel dimensions: length - 1200 mm, width - 300 mm, height - 30 mm; 50mm. Air velocity range in a working channel: 5-120 m/s with a step 0,1 m/s. Mass air rate: 0,2-1,3 kg/s . ... Model/flow temperature difference: up to 120C . ... Aerodynamic unit 'SAU-Siemens' was created to investigate heat exchange intensification on the surfaces with complex relief (dimples, grooves, etc) in flat channels at subsonic flow of working medium (air). ...

Еще в разделе: (Показать все результаты (>6) - termogaz.imec.msu.ru/ )

• aboutLab

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

May 12, 1998 NOTES from May 9, 1998: The format of the Solar Event Lists was changed to include a standard SEC style header. ... Please send comments and suggestions to sec@sec.noaa.gov # # Missing data: //// # # Edited Events for 1998 May 11 # # Event Begin Max End Obs Q Type Loc/Frq Particulars Reg# #------------------------------------------------------------------------------- 2560 A0146 //// 1225 HOL ... The UT day of the event's begin time is the UT day of the list. ...

Еще в разделе: (Показать все результаты (>21) - dbserv.sinp.msu.ru/ )

• BAFIZ at SINP MSU
• Satellite Informations Sector
• ULYSSES Online Data Set Selector

MSU . ... Every year since 2004, the MSU Science Park has conducted an educational program and an innovation project competition called Success Formula (www.successformula.ru). ... In collaboration with the Center of Technology Transfer at Moscow State University and the Chair of Innovation Economics, MSU Science park offers a wide range of educational programs like Success Formula as well as infrastructure projects geared to the incubation of new technology companies on the Moscow University site. ...

Еще в разделе: (Показать все результаты (>13) - www.sciencepark.ru/ )

• MSU Science Park - Prototyping center
• MSU Science Park - News
• MSU Science Park - Services

... Faculties . ... General Information . ... Study and Research . ... The Faculty has 18 departments: Department of General Mathematics , Department of Non-Linear Dynamic Systems and Control Processes, Department of Mathematical Physics, Department of Computational Methods, Department of Research Automation, Department of Operations Research , Department of Optimal Control, Department of System Analysis, Department of Mathematical Statistics, ...

Еще в разделе: (Показать все результаты (>93) - www.msu.ru/ )

• MSU Web Sites
• Faculty of Soil Science
• Faculty of Materials Science

... Cleo batch system is purposed to control parallel tasks on computer clusters. It controls one or more task queues. tasks sceduling (all MPI implemetations are supported, most other parallel environments are supported too) . ... controllable user limits (max used cpus, task work time, etc.) . ... Any task in main will be queued to daughter queues if there aren't enough free own cpus (not shared with daughters). When daughter queues will get enough cpus for this task, it will be runned in main . ...

135. Кафедра математических и компьютерных методов анализа

136. http://www.chem.msu.ru/eng/misc/babaev/papers/032e.pdf

137. OMICS Startup Contest

138. International School ?Computer simulation of advanced materials?, 16?21 July

139. http://seac47-2.phys.msu.ru/proc/E09_Karlik.pdf

140. University Satellites and Space Science Education '2006