... Contact information . ... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty . ... Our goal is to provide researchers from many branches of science, education and industry with innovative tools and methods for solving applied problems using the latest information technologies, modern methods of computation modeling and scientific visualization. ... The uncertainty can be used in further uncertainty estimation of a computational model that uses FetchClimate. ...
... Geography of World Economy . ... Field stations . ... Type of field courses . ... Khibiny station . ... Arkhangelsk station . ... The Arkhangelsk (Ustiayansk) research and training field environmental station is located in Ustiayanskyi district of the Arkhangelsk Region in the interfluve area of Vaga and Northern Dvina rivers. ... Emelianova L.G., Goriayinova I.N., Miaylo E.G. The Life of Taiga (Ecological Excursions in Ustiayanskyi district of the Arkhangelsk Region) M., Arkhangelsk. 1999. 162 pp. ...
О КАФЕДРЕ . ... Трухин В. И. Жиляева В.А. Жиляева А. И. Петрунин Г. И. Список публикаций ћСписок статей . ... Бобров А. В., Жиляева А. И. Минеральные ассоциации включений в гранатах из кимберлитовых трубок Мир и Сытыканская (Якутия) //Вестник НСО. ... A. Zhilyaeva, L. Leonyuk, G.-J. Babonas, G. Bocelli, S. Demishev, N. Leonyuk, V. Maltsev, A. Reza. ... Трухин В.И., Жиляева В.А., Жиляева А.И. Вязкая намагниченность (VRM) базальтов тройственного сочленения Буве (Южная Атлантика) // Физика Земли. ...
... Microstructure deeply influences the properties and thus the functionality of a material. In an X-ray diffraction pattern, the microstructure information is usually extracted from the breadth and shape of line profiles. ... Доклад ?Structure/microstructure and their interplay in nanomaterials and layered systems? оказался очень полезным и интересным для ученых, работающих в области неорганического синтеза и физико-химических методов исследования. ...
On this page you will find a list of images of SN 1998bp which was found in NGC 6495 . ... M1 supernova search has a 1998bp page New 1/8/99 . M.Armstrong discovery image 4/29/98 . ... Spectroscopy has performed by ESO group and Harvard group: they report that SN 1998bp is of type Ia around the maximum, but peculiar. ... 3127 (A.Ap.Suppl, 113, 151 (1995)) ESO group 4500 These three indicate that NGC 6495 is not so near as Virgo cluster; it looks like about three or four times further than Virgo. ...
... Philosophical Transactions of the Royal Society (Biological Sciences) . ... Biochimica et Biophysica Acta (Elsevier Science) . ... Discrete and Continuous Dynamical Systems, Series B (American Institute of Mathematical Sciences) . ... Physics in Medicine and Biology (Institute of Physics) . ... Mathematical Medicine and Biology: A Journal of the IMA . Mathematical Medicine and Biology will publish original articles with a significant mathematical content addressing topics in medicine and biology. ...
Home . Data . ... Meteor-M тДЦ1 . ... Meteor-M тДЦ2 . ... Solar energetic particles . ... Solar flare database (RU) . ... Space Monitoring Data Center of SINP MSU (SMDC) collects the data of space experiments as well as scientific and applied models for studying the geomagnetic and radiation conditions in the near-EarthтАЩs space environment. ... Latest data from featured spacecrafts . Meteor-M #1 is alive! ... Space weather now . ... NOAA N3KL Solar Activity Monitor . ... Developed in 2007. ...
... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...
этой страничке помещены некоторые интернет-адреса, где можно посмотреть на фотографии лишайников , прочитать о лишайниках и лихенологах, а также, найти ссылки на другие лихенологические интернет-ресурсы. http ://www. lichen .com - NORTH AMERICAN LICHEN PROJECT ( фотографии лишайников ). http ://www.sbg.ac.at/pfl/projects/ lichen /index.htm - Lichen Information System (информационная система) ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...
Experimentation and Personality , 1 Explicating the Black Box through Experimentation : Studies of Individual Differences and Cognitive Processes Howard Lavine Department of Political Science, SUNY Stony Brook Stony Brook, NY 11794-4392 Howard.Lavine@sunysb.edu Corresponding Author Milton Lodge Department of Political Science, SUNY Stony Brook Stony Brook, NY 11794-4392 Milton.Lodge@sunysb.edu James Polichak School of Law, University of Michigan ... The Authoritarian Personality. ...
[
Текст
]
Ссылки http://www.suny.msu.ru/ru/Lavine's%20article.pdf -- 94.0 Кб -- 24.08.2010
[
Текст
]
Ссылки http://suny.msu.ru/ru/Lavine's%20article.pdf -- 94.0 Кб -- 24.08.2010 Похожие документы
Information Projects Detectors Staff Publications Contacts . ... Ahn H., Bashindzhagyan G.L., Kuznetsov E.N., Voronin A.G., et al ., ... April Meeting, Jointly Sponsored with the High Energy Astrophisics . Division (HEAD) of the American Astronomical Society, . April 20-23, Albuquerque , New Mexico , USA , Abstracts, . 2002, p . ... Gunasingha R., Bashindzhagyan G.L., Kuznetsov E.N., Voronin A.G., . ...
... Vice-Dean, Physics Department, M.V.Lomonosov Moscow State University . Vice-Director, International Laser Center, M.V.Lomonosov Moscow State University . ... International Laser Center and Faculty of Physics . ... Radiophysics including Quantum Electronics . ... Victor Zadkov's current research interests are in the field of laser physics, interaction of laser radiation with matter, molecular dynamics of photoexcited molecules, coherent control, quantum optics and physics of quantum information. ...
The Department of Talented Youth Affairs and Professional Orientation . ... Projects . ... From 1 to 6 July 2014 there were held the third championship of the ?SanSat in Russia? which took place in Dubna (Moscow) ? ... CanSat is a model of microsatellite weighing about 350 grams. CanSat project started in 1999. ... Participants at the third championship were offered a large educational and excursion programs. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...
... American), headings and the style of referencing. ... The opening page of a contribution in the NATO book series should always be a right hand page and should consist of: the title in capital letters, bold font, flush left, on the fourth text line; followed by the subtitle (if present) in italics, flush left, with one line of white above. ... First-order Heading This heading is in bold, upper and lowercase letters, numbered in arabic figures, and has two lines of space above and one line below. ...
[
Текст
]
Ссылки http://www.mgumus.chem.msu.ru/arw/natocamera-ready.doc -- 43.0 Кб -- 09.10.2002
[
Текст
]
Ссылки http://mgumus.chem.msu.ru/arw/natocamera-ready.doc -- 43.0 Кб -- 09.10.2002 Похожие документы
THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...
Organometallics 1997, 16, 411-418 411 Mechanism of Alkyne Insertion into the Ru-C Bonds of Orthoruthenated Compounds Featuring Similarity of the Ru(II) and Pd(II) Reactions Wolfgang Ferstl,,1 Inna K. Sakodinskaya, Nohma Beydoun-Sutter,§ Guy Le Borgne,| ... Chem. ... Effect of LiCl and NaClO4 on the rate constants k2 for insertion of PhCtCPh into Ru-C bond of 1a in MeOH at 25 °C. [1a] ) 3.7 в 10-4 M, and [PhCtCPh] ) 1.7 в 10-2 M. Inset: Rate constants plotted against calculated concentration of Cl-. ...
... About Space Monitoring Laboratory, scientific directions, instruments, contacts . ... В XXI веке в оптической астрономии появился новый мощный инструмент исследования Вселенной - синоптические обзоры или синоптические телескопы. ... Но если иметь в виду астрофизический объект вам обязательно понадобится спектральный телескоп, чтобы понять его физическую природу или установить его подтип. ... В основном спектральные телескопы имеют диаметры до 2-3 метров (таких телескопов в мире более 50). ... МАСТЕР...