О КАФЕДРЕ . ... Трухин В. И. Жиляева В.А. Жиляева А. И. Петрунин Г. И. Список публикаций ћСписок статей . ... Бобров А. В., Жиляева А. И. Минеральные ассоциации включений в гранатах из кимберлитовых трубок Мир и Сытыканская (Якутия) //Вестник НСО. ... A. Zhilyaeva, L. Leonyuk, G.-J. Babonas, G. Bocelli, S. Demishev, N. Leonyuk, V. Maltsev, A. Reza. ... Трухин В.И., Жиляева В.А., Жиляева А.И. Вязкая намагниченность (VRM) базальтов тройственного сочленения Буве (Южная Атлантика) // Физика Земли. ...

Еще в разделе: (Показать все результаты (>3) - geo.phys.msu.ru/ )

... Microstructure deeply influences the properties and thus the functionality of a material. In an X-ray diffraction pattern, the microstructure information is usually extracted from the breadth and shape of line profiles. ... Доклад ?Structure/microstructure and their interplay in nanomaterials and layered systems? оказался очень полезным и интересным для ученых, работающих в области неорганического синтеза и физико-химических методов исследования. ...

Еще в разделе: (Показать все результаты (>8) - nano.msu.ru/ )

On this page you will find a list of images of SN 1998bp which was found in NGC 6495 . ... M1 supernova search has a 1998bp page New 1/8/99 . M.Armstrong discovery image 4/29/98 . ... Spectroscopy has performed by ESO group and Harvard group: they report that SN 1998bp is of type Ia around the maximum, but peculiar. ... 3127 (A.Ap.Suppl, 113, 151 (1995)) ESO group 4500 These three indicate that NGC 6495 is not so near as Virgo cluster; it looks like about three or four times further than Virgo. ...

Еще в разделе: (Показать все результаты (>11) - www.rochesterastronomy.org/ )

• Supernova 2002bl in UGC 5499

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>8) - iconolat13.phys.msu.ru/ )

... Journal of Culture Collections [J Culture Collect] . Common information . ... no information] . ... 1310-8360 . ... since 1995-01-01 till today . ... National Bank for Industrial Microorganisms and Cell Cultures. FREE journal! ... http://www.bioline.org.br/cc . ... 1995-01-01 . today . toc, abstract, full-text . http://www.bioline.org.br/toc?id=cc . ...

Еще в разделе: (Показать все результаты (>49) - journals.genebee.msu.ru/ )

The VLT Survey Telescope: a year after its coming into operation Massimo Capaccioli Department of Physics, University of Naples Federico II National Institute of Astrophysics - VST center at Naples The VLT Survey Telescope (VST) is a 2.6 m wide field optical telescope located at the Cerro Paranal Observatory of ESO in the Chilean Andes. ... The wide field is sampled by OmegaCam, a camera with a mosaic of 32 CCD for a total of 256 Mpixels, provided by the homonymous consortium. ...

Еще в разделе: (Показать все результаты (>11) - master.sai.msu.ru/ )

• SAI Space Monitoring Laboratory
• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists

Home . Data . ... Meteor-M тДЦ1 . ... Meteor-M тДЦ2 . ... Solar energetic particles . ... Solar flare database (RU) . ... Space Monitoring Data Center of SINP MSU (SMDC) collects the data of space experiments as well as scientific and applied models for studying the geomagnetic and radiation conditions in the near-EarthтАЩs space environment. ... Latest data from featured spacecrafts . Meteor-M #1 is alive! ... Space weather now . ... NOAA N3KL Solar Activity Monitor . ... Developed in 2007. ...

Еще в разделе: (Показать все результаты (>8) - smdc.sinp.msu.ru/ )

... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...

Еще в разделе: (Показать все результаты (>3) - physelec.phys.msu.ru/ )

• http://physelec.phys.msu.ru/staff/zykovapubl.doc

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• ConClus

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>4) - srd.sinp.msu.ru/ )

... Vice-Dean, Physics Department, M.V.Lomonosov Moscow State University . Vice-Director, International Laser Center, M.V.Lomonosov Moscow State University . ... International Laser Center and Faculty of Physics . ... Radiophysics including Quantum Electronics . ... Victor Zadkov's current research interests are in the field of laser physics, interaction of laser radiation with matter, molecular dynamics of photoexcited molecules, coherent control, quantum optics and physics of quantum information. ...

Еще в разделе: (Показать все результаты (>43) - qilab.phys.msu.ru/ )

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>8) - observ.pereplet.ru/ )

The Department of Talented Youth Affairs and Professional Orientation . ... December 19, 2015 the All-Russian National History test was held. 22439 people in 75 regions of Russia took part in the test. ... the head The Department of Talented Youth Affairs and Professional Orientation T.V. Kortava, the acting dean of the History Faculty of Moscow State University I.I. Tuchkov and others. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>41) - talant.msu.ru/ )

• MSU CNIR visited the Republic of Korea in the delegation of ?Sport
• National intellectual development Fund paid trips to summer school | The
• Robot Ball ? 2014 | The Department of Talented Youth Affairs and Professional

Lomonosov Moscow State University was established in 1755 . ... Lomonosov Moscow State University Diary . ... MSU Web Sites . ... Study and Research . ... MSU Online . ... Research Priorities in the Humanities at MSU: . Faculty of History . ... History of Moscow State University . ... Research Priorities in Social Sciences at MSU: . ... Research Priorities in Sciences and Humanities at MSU: . ... Innovative technologies in teaching social-economic disciplines and the humanities in universities . ...

Еще в разделе: (Показать все результаты (>60) - www.msu.ru/ )

• Faculty of Soil Science

... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...

Еще в разделе: (Показать все результаты (>18) - phys.web.ru/ )

... Publications . ... SPDC Laboratory . Quantum Electronics Chair . ... Generation of Polarization Entangled States in Spatially Inhomogeneous Ferroelectrics?, Advanced Science Letters, 2 (4), 430?447 (2009). ... Download [ help ]: . ... Copyright notice: This material is presented to ensure timely dissemination of scholarly and technical work. ... All persons copying this information are expected to adhere to the terms and constraints invoked by each author's copyright. ...

Еще в разделе: (Показать все результаты (>48) - qi.phys.msu.ru/ )

1, 120102 (2012) 2D- - . ... 2D- - E-mail: kozlov@polly.phys.msu.ru 2012 120102-1 [4, 7], . ... 2D- - 1, 120102 (2012) 1D- , x n+1 . ... 5: (), ( ) P () a = 1.9 = 0.1 t = 10000 . ... 2] Kaneko K. Chaos. ... E-mail: kozlov@pol ly.phys.msu.ru In the field of synchronization processes coupled map lattices (CML) represent paradigmatic models of extended systems exhibiting spatiotemporal chaos, self-organization and synchronization due to the rich variety of global qualitative behavior. ... 2012 120102-8 ...

Еще в разделе: (Показать все результаты (>3) - uzmu.phys.msu.ru/ )

• http://uzmu.phys.msu.ru/issue/120103.pdf

... Chemical Department . ... 7 (495) 939-31-70, Fax: +7 (495) 939-31-70, +7 (495) 939-54-17 . ... 1999 - 2004 . Master's Degree, The M.V. Lomonosov Moscow State University, Chemical Faculty, Chemical Enzymology Department (2004) . ... Strong background in Chemistry (Biochemistry, Organic chemistry, Analytical chemistry, Inorganic chemistry, Physical chemistry, Chemistry of polymers, Radio-chemistry), biochemistry, molecular biology, Physics (course of Theoretical physics, the Theoretical mechanics) . ...

Еще в разделе: (Показать все результаты (>77) - www.enzyme.chem.msu.ru/ )

Химический факультет МГУ имени М.В. Ломоносова . КАФЕДРА НЕОРГАНИЧЕСКОЙ ХИМИИ . ... Неорганическая химия в ВУЗах России . ... Руководитель: Казин Павел Евгеньевич, д.х.н., профессор ( http://istina.msu.ru/profile/Kazin/ ). Местоположение: рекреация БХА (Химический факультет МГУ), +7 (495) 939 - 34 - 40, kazin @ inorg.chem.msu.ru . ... P.E. Kazin, M.A. Zykin, Y.V. Zubavichus, O.V. Magdysyuk, R.E. Dinnebier, M. Jansen. ... P.E. Kazin, L.A. Trusov, D.D. Zaitsev, and Yu.D. Tret'yakov. ...

Еще в разделе: (Показать все результаты (>30) - www.inorg.chem.msu.ru/ )

• IV National crystal chemical conferene Chernogolovka 2006
• Inorganic Chemistry Division
• List of research papers of Prof

Solar proton anisotropy and dropout effects in the polar cap and auroral zone during period of the extended substorm activity Kuznetsov S.N., and Lazutin L.L. Institute of Nuclear Physics, Moscow State University, Vorob'evy gory, Moscow, 119899 Russia Abstract. ... Dropout effects of the proton radial distribution were found suggesting specific field line stretching inside the magneosphere trapping region during period of extended substorm activity. ... Fig 1. ...

Еще в разделе: (Показать все результаты (>69) - www.kosmofizika.ru/ )

• http://www.kosmofizika.ru/pdf1/abel_02b.pdf
• http://www.kosmofizika.ru/pdf2/e_p_apatity08.pdf
• http://www.kosmofizika.ru/pdf2/ap_seminar06.pdf