... ВШБ МГУ - школе . ... В газете The Northeastern Voice (Northeastern University) вышла статья про стажировку студентов Высшей школы бизнеса МГУ в Бостоне. ... Puffer and McCarthy, who have worked for years with Moscow State University faculty, said MSU professor Alexander Naumov who has also taught at Northeastern, and who coauthored a book with Puffer proposed the program earlier in the year. ...
Генетическая кристаллохимия . ... Исследуются причинно-следственные связи структурных преобразований в гомологических и морфотропных рядах минералов. ... На примере минеральных групп фосфатов, боратов, силикатов, ванадилфосфатов и борофосфатов прослеживаются пути формирования и преобразования кристаллических структур минералов в породах различных геохимических типов . ... Типоморфизм минералов. ... Якубович О.В., Урусов В.С. Генетическая кристаллохимия фосфатов гранитных пегматитов // Вестник МГУ. ...
... Contact information . ... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty . ... Our goal is to provide researchers from many branches of science, education and industry with innovative tools and methods for solving applied problems using the latest information technologies, modern methods of computation modeling and scientific visualization. ... The uncertainty can be used in further uncertainty estimation of a computational model that uses FetchClimate. ...
... Geography of World Economy . ... Field stations . ... Type of field courses . ... Khibiny station . ... Arkhangelsk station . ... The Arkhangelsk (Ustiayansk) research and training field environmental station is located in Ustiayanskyi district of the Arkhangelsk Region in the interfluve area of Vaga and Northern Dvina rivers. ... Emelianova L.G., Goriayinova I.N., Miaylo E.G. The Life of Taiga (Ecological Excursions in Ustiayanskyi district of the Arkhangelsk Region) M., Arkhangelsk. 1999. 162 pp. ...
О КАФЕДРЕ . ... Трухин В. И. Жиляева В.А. Жиляева А. И. Петрунин Г. И. Список публикаций ћСписок статей . ... Бобров А. В., Жиляева А. И. Минеральные ассоциации включений в гранатах из кимберлитовых трубок Мир и Сытыканская (Якутия) //Вестник НСО. ... A. Zhilyaeva, L. Leonyuk, G.-J. Babonas, G. Bocelli, S. Demishev, N. Leonyuk, V. Maltsev, A. Reza. ... Трухин В.И., Жиляева В.А., Жиляева А.И. Вязкая намагниченность (VRM) базальтов тройственного сочленения Буве (Южная Атлантика) // Физика Земли. ...
... Microstructure deeply influences the properties and thus the functionality of a material. In an X-ray diffraction pattern, the microstructure information is usually extracted from the breadth and shape of line profiles. ... Доклад ?Structure/microstructure and their interplay in nanomaterials and layered systems? оказался очень полезным и интересным для ученых, работающих в области неорганического синтеза и физико-химических методов исследования. ...
On this page you will find a list of images of SN 1998bp which was found in NGC 6495 . ... M1 supernova search has a 1998bp page New 1/8/99 . M.Armstrong discovery image 4/29/98 . ... Spectroscopy has performed by ESO group and Harvard group: they report that SN 1998bp is of type Ia around the maximum, but peculiar. ... 3127 (A.Ap.Suppl, 113, 151 (1995)) ESO group 4500 These three indicate that NGC 6495 is not so near as Virgo cluster; it looks like about three or four times further than Virgo. ...
... Philosophical Transactions of the Royal Society (Biological Sciences) . ... Biochimica et Biophysica Acta (Elsevier Science) . ... Discrete and Continuous Dynamical Systems, Series B (American Institute of Mathematical Sciences) . ... Physics in Medicine and Biology (Institute of Physics) . ... Mathematical Medicine and Biology: A Journal of the IMA . Mathematical Medicine and Biology will publish original articles with a significant mathematical content addressing topics in medicine and biology. ...
THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...
... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...
этой страничке помещены некоторые интернет-адреса, где можно посмотреть на фотографии лишайников , прочитать о лишайниках и лихенологах, а также, найти ссылки на другие лихенологические интернет-ресурсы. http ://www. lichen .com - NORTH AMERICAN LICHEN PROJECT ( фотографии лишайников ). http ://www.sbg.ac.at/pfl/projects/ lichen /index.htm - Lichen Information System (информационная система) ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...
Information Projects Detectors Staff Publications Contacts . ... Ahn H., Bashindzhagyan G.L., Kuznetsov E.N., Voronin A.G., et al ., ... April Meeting, Jointly Sponsored with the High Energy Astrophisics . Division (HEAD) of the American Astronomical Society, . April 20-23, Albuquerque , New Mexico , USA , Abstracts, . 2002, p . ... Gunasingha R., Bashindzhagyan G.L., Kuznetsov E.N., Voronin A.G., . ...
... Vice-Dean, Physics Department, M.V.Lomonosov Moscow State University . Vice-Director, International Laser Center, M.V.Lomonosov Moscow State University . ... International Laser Center and Faculty of Physics . ... Radiophysics including Quantum Electronics . ... Victor Zadkov's current research interests are in the field of laser physics, interaction of laser radiation with matter, molecular dynamics of photoexcited molecules, coherent control, quantum optics and physics of quantum information. ...
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
Full-text editions of historical sources . on the history of Russia (in Russian) . on the Internet . ... Collection of electronic resources on history . from the library of historical sources . on our site . ... Library 'Museum of the Decembrists' - documents concerning the Decembrist insurrection of 1825. http://decemb.hobby.ru/ . ... Several sources on Russian history are on a site with documents on the history of Finland. http://www.pp.clinet.fi/~pkr01/historia/history.html . ...
... по материалам бюллетеня The American Institute of Physics Bulletin of Physics News Number 476 March 24, 2000). ... Позднее John Pendry получил отрицательную диэлектрическую проницаемость в системе, состоящей из ряда проволок (Pendry et al., ... Sheldon Schultz ( sschultz@ucsd.edu ) и David Smith ( drs@sdss.ucsd.edu ), следуя предписаниям Pendry, смогли создать материал с отрицательными значениями обоих проницаемостей, по крайней мере, в микроволновом диапазоне частот . ...
... Faculties . ... The Faculty of Foreign Languages and Area Studies was founded at Lomonosov Moscow State University in 1988. ... Theory and Methodology of Foreign Language Teaching . ... The core courses include studies in linguistic theory, verbal communication theory, information and communication technology for linguistics, courses in two foreign languages, as well as other courses tailored to the programme's needs. ... Theory of Foreign Language Teaching and Intercultural Communication . ...