Lomonosov Moscow State University was established in 1755 . ... MSU Web Sites . ... Faculties . ... Study and Research . ... MSU Online . ... Bachelor's degree takes 4 academic years to complete. ... FIRST STEP ? ... SECOND STEP ? COME TO MOSCOW, RUSSIA AND BRING ALL ORIGINAL DOCUMENTS WITH YOU . ... To get a letter of invitation, necessary for receiving a student visa, please send (via mail, fax or e-mail) the following documents to the Department of international studies of the chosen faculty: . ...

Еще в разделе: (Показать все результаты (>53) - www.msu.ru/ )

• Master studies
• Post-graduate studies
• Specialist studies

... 6 Pro Contra Generally strong institutions Large human capital Resource base Developed economy Arc hie Brown, Steve Cohen Complex and vulnerable state structure Lost economic and social dynamism, deepening systemic crisis (failing growth rates, growing crime rate , expansion of cynicism) Rigid politic and economic system Over-militarization of economy Lack of civil society 7 Big leap forward, instead of ordered transition Political ... Have you lost or gained during the transition? ...

Еще в разделе: (Показать все результаты (>18) - www.mse-msu.ru/ )

The Nine Planets is best viewed on-line via a graphical WWW browser which displays the pictures in color and supports hypertext link traversal. ... To view the movies and hear the sounds, you'll need additional helper programs. ... I recommend that you use Netscape as your browser. Netscape can display gif and jpeg images directly without need of any additional helper apps. You do need additional helper apps for movies and sounds, however. ... Yahoo's Helper Applications .. ... Tech Help .. ...

Еще в разделе: (Показать все результаты (>2) - www.iki.rssi.ru/ )

... Написать комментарий . ... Астрокартинка дня: "Загадка в гамма-лучах" . ... На фото, представленном на сайте " Astronomy Picture of the Day ", изображение неба в гамма-лучах , полученное гамма-детектором "Egret" с борта обсерватории " Комптон " еще в 90-е годы. ... Да, в этих лучах открыто много загадочных явлений и самое поразительное - это гамма-всплески . ... Еще в 70-е годы наши астрофизики накопили самый обширный материал по гамма-всплескам. ...

Еще в разделе: (Показать все результаты (>155) - www.nature.web.ru/ )

• Научная Сеть
• Астрономической картинке дня шесть лет!
• Second International Digital Earth Symposium

... Payment is made at transfer of means for the University account All expenses of transferring the money to the University account are beard by the Student. In the event the Student is expelled by the University for the lack of academic progress; transgression of the sections stated in Article 3; for the Student's own personal reasons; for medical reasons confirmed by the official medical paper, all payments made are non-refundable. Article 2 Obligation and rights of the University 2.1. ...

Еще в разделе: (Показать все результаты (>16) - foroff.phys.msu.ru/ )

• The Faculty System of Education
• Admission Regulation

... The S.P.Novikov Seminar came into being in the mid-sixties. ... 1] L.A.Alaniya, On manifolds of the Alexander type// Uspekhi Mat. Nauk, V. 46 ,1991, P. 179-180. ... Nauk SSSR, V.43, 1979, P. 104-240. ... 11] V.M.Bukhshtaber, A.S.Mishchenko, S.P.Novikov, Formal groups and their role in the apparatus of algebraic topology// Uspekhi Mat. ... Some applications to differential topology and to the theory of characteristic classes// Izv.Akad.Nauk SSSR, V. 34, 1970 I N2, P. 253-288; II: N3, P. 475-500. ...

Еще в разделе: (Показать все результаты (>141) - higeom.math.msu.su/ )

• Alexey Garber (Russian)
• Index of /~asmish/Lichnaja-2010/Version2010-11-20
• C*-algebras: Talks

... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...

Еще в разделе: (Показать все результаты (>29) - nanofluidics.phys.msu.ru/ )

• Laboratory of Micro- and Nanofluidics

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ THE NEW GRIDDED KURIL-KAMCHATKA BATHYMETRY FOR TSUNAMI MODELING An. ... For calculations in each grid point where the depth is to be found the algorithm uses up to 9 points from data source. ... Then the spline interpolation is used for defining the depth value in the grid-point. ... Hydrographic Survey Data, CD-ROM data set, Ver. ...

Еще в разделе: (Показать все результаты (>21) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION -- Official information

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>42) - srcc.msu.ru/ )

• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial
• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial

... Separation of all runs on several groups by mean active sectors. ... Ways to carry out step 2: trying to cut off all points which don't reach the fit line with errors. Ways to carry out step 2: mean active sectors selection Ways to carry out step 2: results of mean active sectors selection by example of set 2 Failing of mean active sector selection method on example of set 3: one point is still on the graph Introduction of new distance parameter How to find an optimal distance parameter? ...

Еще в разделе: (Показать все результаты (>14) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%202.pdf

STRING THEORY AND UNIFICATION OF FUNDAMENTAL INTERACTIONS I. L. BUCHBINDER The basic physical ideas of a theory that aims at unifying all fundamental interactions, the so-called superstring theory , which is now being actively developed, are discussed. The problem of unifying gravity with other fundamental interactions is outlined. ... The major accomplishments and prospects of the superstring theory are discussed. 2001 , . ... 1984 , . ... 4 100 , 7, 7, 2001 . ... 101 ...

Еще в разделе: (Показать все результаты (>130) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/mirrors/2001_2b.pdf
• Альфа-распад (измерения)
• The Caucasus, 1947 On Shkhelda-tau’s second Western summit

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• Align tool for DNA-protein complexes
• ConClus

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

136. TEPA 2012 | Thunderstorms and Elementary Particle Acceleration

137. http://lizard.phys.msu.su/home/science/redistr-sst99.pdf

138. Reversibility of nucleoside diphosphate kinase solubilization from the surface

139. Visa Support Information

140. http://theorphys.phys.msu.ru/education/aqft_slides/ExamSyllabus_Term1.pdf