... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• ConClus

T.V. Tyupikova, V.N. Samoilov The automated networks of management of financial activity, the control and the account of databases of economic divisions Joint Institute for Nuclear Research. ... Now let's consider concepts "an elementary object" and "a conditional unit of the information" with reference to systems of the analysis and management of the financial and economic activity of anthe enterprise. ... The address part of the elementary object is the number of the account (or of the subaccounts). ...

Еще в разделе: (Показать все результаты (>35) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/radchenko/MolecularTiggersforInternet.doc
• http://acat02.sinp.msu.ru/presentations/vaiciulis/acat2002.ps
• http://acat02.sinp.msu.ru/presentations/kolbasova/acat.pdf

Это новая версия каталога журналов, первоначально созданная Владимиром Мельгуновым. ... Журналы, издаваемые 'BioMed Central' . ... BioMed Central ] . medicine . ... Algorithms for Molecular Biology . ... Annals of Clinical Microbiology and Antimicrobials . ... Bioinformatics BMC . ... BMC Biology . ... BMC Cardiovascular Disorders . ... BMC Cell Biology . ... BMC Chemical Biology . ... BMC Clinical Pathology . ... BMC Clinical Pharmacology . ... BMC Developmental Biology . ... JCatalog | ...

Еще в разделе: (Показать все результаты (>247) - journals.genebee.msu.ru/ )

• JCatalog journal list

... Classification of the engineering geological Earth's structures and their characteristic (Project manager – Prof. Trofimov V.T.; investigator – Ass. ... Artificial soils as a result of technogenesis (Project manager - Prof. Trofimov V.T.; investigator - Ass. ... Tgheoretical problems of evolution of engineering geological Earth's conditions at the epoch of technogenesis (Project manager - Prof. Trofimov V.T.; investigator – Senior Research Worker Kyrinov M.B.); . ... Project manager . ... 1998-2000 ...

Еще в разделе: (Показать все результаты (>50) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/petro/Perchuk_publ/perchuk-Geol99.pdf
• http://www.geol.msu.ru/deps/petro/Perchuk_publ/MorgunovaPerchuk.pdf
• Faculty of Geology >> Geology at Moscow State University

... 96-05-65519, отчет за 1997 год) . ... Dynamics of srtike-slip magmatic duplexes . ... During 1997, we conducted (1) field works in the South Ural area (for account of another financial sources), (2) theoretical investigations of the earlier studied strike-slip magmatic duplexes from Central Kazakhstan and the Kola-Karelian region, (3) analitical study of magmatic rocks composition (for account of another financial sources), and (4) development of computer databases and software. ...

Еще в разделе: (Показать все результаты (>21) - sbmg.geol.msu.ru/ )

• Europrobe1
• Strassburg

A very important stage in a story of formation of any new science is the shift from discussion of situation which are possible but do not occur in practice due to some reason to recognition of real phenomena of interest. ... We suggest to consider computer viruses as this new specific form of life which is coming in the contact with our form of life. ... Computer life has been created by human being, the role of independent evolution of computer viruses seems to be still negligible. ...

Еще в разделе: (Показать все результаты (>141) - lnfm1.sai.msu.ru/ )

• http://neptun.sai.msu.ru/~zasov/articles/mini-bars.ps
• Trudy GAISH, vol. LXV, 1996, Abstracts in English
• Manpage of FITSHDR_EXPAND

Uneex . SeminarFeature . ... Определение спама как нежелательной почты в противовес массовой рассылке . Классические методы защиты от спама и их недостатки . ... Методы, основанные на поведении спамера: Greylisting , TMDA и т. п. Основной источник спама, обходящего классические методы защиты . ... Общая схема построения (feature-based) классификаторов . ... Copyright 2003 by the contributing authors. ... Send feedback to svv at cmc dot msu dot ru. ...

Еще в разделе: (Показать все результаты (>4) - uneex.cs.msu.su/ )

... Loke's and Barker's "deconvolution" idea is to represent the cross-section under the VES observation line by a set of 2D blocks with fixed boundaries and certain initial values of blocks' resisitivity. ... The TRF_2D for Windows program processes the traverse of VES with current line along the observation line. Three arrays date can be processed: . ... Up to 100 sounding points on the observation line. Up to 20 arbitrary current electrode spasings per sounding point. ...

Еще в разделе: (Показать все результаты (>37) - geophys.geol.msu.ru/ )

• TRF_2d. Page 4.

... About Us . ... Research . ... Besides History students, it taught English to Law, Economics and Philosophy students. At present, the Department of English for the Humanities is an integral part of the Faculty of Foreign Languages and Area Studies. At the department, the English language is taught to both undergraduates and postgraduates (at Masters and Doctoral level) from the following faculties: . ... Our academic staff are committed to the highest standards of teaching and research. ...

Еще в разделе: (Показать все результаты (>38) - ffl.msu.ru/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>6) - iconolat13.phys.msu.ru/ )

• Program overview

... About CIE MSU . Academic Programmes . ... Student's Life . ... Vestnik CIE (in Russian) . ... Distance Learning . The Center offers an engaging online interactive course of the Russian language and culture for intermediate and advanced students Russia On Air . The course is designed to help learners gain an expanded view of contemporary Russia through Russian mass media. ... take charge of your learning the Russian language and organize it in a way that is most suitable for you. ...

Еще в разделе: (Показать все результаты (>14) - www.cie.ru/ )

• Elective Courses :: Academic Programmes :: CIE

... Resources . ... info@ecfs.msu.ru . All contacts . ... Eurasian Center . for Food Security . ... Comments: 0 . 15 october 2015 . ... Agriculture and the rural sector in general, is a major determinant of livelihoods in Europe and Central Asia (ECA). ... In Central Asia/Caucasus, most of the poor are in rural areas, where agriculture employs half of the population. ... International Forum on Eurasian Food Security and Nutrition Network and Eurasian Soil Partnership read . ... Contacts . ...

Еще в разделе: (Показать все результаты (>17) - ecfs.msu.ru/ )

• The world Bank's agriculture and rural development in the region Europe and

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>6) - lvk.cs.msu.su/ )

... 2.1. ... Random Access Memory ­ RAM). ... Dynamic RAM ­ DRAM), , ) , . Static RAM ­ SRAM), ( ). , , , .. (1-2 4 6 ). . ... 1 5 8086 Intel 135 , . ... EDSAC (Electronic Delay Storage Automatic Calculator ­ ) 3 [3]. ... EDSAC ( ), 100 . ... 1 8 , , , ( ­ circuits). () , ( ) (). : ( false) ( true)1. 1 , 2 ­ . ... true), ( false) . ... 1000 , (), 10000 ­ (), 100000 ­ (), () . ... 2014 Intel Intel Edson . ... 1000 , 10000 (, 8051, , 60000 ). ... x y, ­ , , , ( a b), x+y. x y (0 false 1 true), , . ...

135. Mineralogy and Gemmology

136. BDRG | Университетский спутник "Ломоносов"

137. Supernova 1987A in LMC

138. http://seac47-2.phys.msu.ru/proc/E06_Gusiakov.pdf

139. RNA Alignment

140. Microsoft Exchange - Outlook Web Access