... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>4) - sinp.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>41) - lav01.sinp.msu.ru/ )

List of available DNA-protein and RNA-protein complexes . List of Pfam domains presented in DNA-protein and RNA-protein complexes . List of SCOP domains presented in DNA-protein and RNA-protein complexes . ... Amino acid code changer : 3-letter code to 1-letter code and vice versa . The work is supported by the Russian Foundation of Basic Research, grants 06-07-89143 and 06-04-49558, and INTAS, grant 05-1000008-8028 ...

Еще в разделе: (Показать все результаты (>36) - monkey.belozersky.msu.ru/ )

• About this project
• Search for potential hydrogen bonds between protein and nucleic acid
• Search for potential water bridges between protein and nucleic acid

Вход в личный кабинет . ... Ярмарка вакансий и стажировок для студентов и выпускников вузов . Новости науки и техники События . ... Подписаться на новости . Вакансии . ... Компания: Nielsen company . The Nielsen Company is a market-leading information & media company with more than 41,000 employees in 100+ countries around the world. ... Please send your CV before June 9th marked in Subject line Summer Internship Program at: RussiaMoscow.HR@nielsen.com or info.russia@nielsen.com . ...

Еще в разделе: (Показать все результаты (>89) - www.physcareer.ru/ )

Title Author Key words Review of the monograph Yu.G. Volkova "Creativity: creativity against imitation" Dmitriev A.V. creative class, creativity, creative, imitation This article is reviewed monograph Yu.G. Volkova "Creativity: creativity against imitation" (2013). ...

Еще в разделе: (Показать все результаты (>34) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2011/2/05.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/2/11.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/4/17.pdf

... Sections . ... Atlas "Birds of Moscow City" . ... Breeding bird atlas of European Russia . ... Annual report, issue 1 . ... The Fauna and Abundance of European Russia Birds", issue 1 . ... Br eeding bird atlas of European Russia . ... Project outputs : Accurate mapping of Russian birds in the 2nd European Breeding Bird Atlas, and a groundbreaking Atlas of Breeding Birds of European Russia . ... Atlas "Birds of Moscow City" Monitoring of common birds Breeding bird atlas of European Russia . ...

Еще в разделе: (Показать все результаты (>919) - zmmu.msu.ru/ )

• Collection of books
• Monitoring of common birds
• Section of the scientific public oriented projects

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ HYDROACOUSTIC ANTENNA : A POWERFUL TOOL TO FORECAST TSUNAMIGENIC EARTHQUAKES Yakov S. Karlik Central Research Institute MORPHYSPRIBOR , 46 Chkalovsky proezd, Sankt-Petersburg, 197378 Russia E-mail: karlik@mail.cl.spb.ru ABSTRACT Hydroacoustic antenna ... 2001). ... Eiby, J.A., 1982: Earthquakes. ...

Еще в разделе: (Показать все результаты (>19) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E12_Marchuk.pdf

... Поиск по МГУ | Лента новостей | ... О проекте . ... Please, enter the code that you see below in the input field. This is for blocking bots that try to post this form automatically. If the code is hard to read, then just try to guess it right. If you enter the wrong code, a new image is created and you get another chance to enter it right. ... 2003 2011 MsuNews.Ru Новости МГУ . 2003 2011 Разработка и дизайн MMForce.Net . ... Экспорт новостей (RSS) ...

Еще в разделе: (Показать все результаты (>41) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ
• MsuNews.Ru | Блог проекта
• MsuNews.Ru | Энциклопедия

... ECOLOGICAL COOPERATION" . ... Brjanskaja oblast, Dubrovskij rajon, Seshcha (village), School . Brjanskaja oblast, Djat'kovskij rajon, Bytosh (village), School . ... Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Borodino (village), School . Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Yardenikha (village), School . ... Moscow, Children's Ecological Center of the National Park "Losinyj Ostrov" - the coordinator of ecological work of 18 Korolev-town's schools . Moscow, School #222 . ...

Еще в разделе: (Показать все результаты (>16) - www.ecocoop.ru/ )

... About the project . ... Biological information . As part of the project areas we will develop the scientific basis for the creation of infrastructure solutions and knowledge-based platforms for a comprehensive biodiversity study in Russia on the basis of genomic and storage technologies, analysis and exchange of data different types. ... Solution of problems set out in the project area will have the long-term effect in the various fields of science and engineering disciplines in the social sphere. ...

Еще в разделе: (Показать все результаты (>6) - depository.msu.ru/ )

• depozitariy | Living systems depository "Noah's Ark"
• Microorganism and fungi | depozitariy
• Main grant | depozitariy

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: €аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>28) - ecfs.msu.ru/ )

• Forums | ECFS
• Ongoing consultations/ Текущие онлайн конференции | ECFS

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

... Главная Факультет политологии Новости факультета Новость . ... На заседании Ученого совета факультета политологии МГУ состоялось торжественное вручение сертификата призеру международного конкурса эссе на английском языке ?Creating the Future We Want?. Декан факультета политологии профессор А. Ю. Шутов поздравил студента III курса Павла Воробьева и вручил ему от имени организаторов конкурса сертификат за глубокое понимание и раскрытие темы. ... Поступление на факультет политологии в 2016 году . ...

Еще в разделе: (Показать все результаты (>7) - polit.msu.ru/ )

• Новости факультета

... Geography of World Economy . ... Recreational Geography and International Tourism . ... Departments . ... Field training . ... The department curriculum is focused on preparation of experts of the top skills in the field of tourist business, tourist service, the government in tourism sphere. ... A theme of scientific work of department Territorial touristic-recreational systems: natural and social and economic preconditions of a sustainable development includes three underthemes. ...

Еще в разделе: (Показать все результаты (>47) - eng.geogr.msu.ru/ )

• Department of Cartography and Geoinformatics
• Undergraduate study
• Department of Oceanology

Lomonosov Moscow State University . ... About Us . ... Further Education Programs . ... General Information . ... The Department of Linguistics and Information Technologies . ... The Department of Linguistics and Information Technologies was founded in 2008. ... The latest publication (?21, June 2012, 'Information Technology in Linguistics') was about the Fifth International Scientific and Methodological Conference 'ICT in Linguistics, Foreign Language Teaching and Intercultural Communication'. ...

Еще в разделе: (Показать все результаты (>126) - ffl.msu.ru/ )

• Научная жизнь

Home People Activities Research Publications . ... Containers for image storage in memory, reading and writing of image files, Pipeline filtering library, D.Yurin "On the Images Pipe Line Filtering, PDF , color spaces, fast convolutions, image registration algorithms, edge curvature estimation via differential invariants (under development) , Bresenham algorithms, some numerical algorithms etc. ... Download help on project (CHM) , generated via doxygen (see How to document program's code ) . ...

Еще в разделе: (Показать все результаты (>20) - imaging.cs.msu.ru/ )

... Behaviour of Oscillators System in Acoustic Field . ... At present a realization of catalytic reactions in artificially created non-steady- state conditions with the aim of increasing of their effectiveness is widely used. In the given paper the possibility of control by catalytic processes effectiveness by means of acoustic field is investigated. ... As a result the behaviour of system consisting from two types of non-harmonic oscillators is investigated in acoustic field. ...

Еще в разделе: (Показать все результаты (>164) - acs366.phys.msu.su/ )

• AUTHOR : Filonenko E
• AUTHOR : Gavrilov L

Theory as a Lighthouse in the Electrochemical Ocean . In memory of Alexander M. Kuznetsov . ... Until his last days he continued to work on various aspects of charge transfer phenomena. ... In electrochemical kinetics the theory always outruns the experiment, and the quantum mechanical theory of charge transfer created in the famous Theoretical Department of the Frumkin Institute in Moscow (R.R. Dogonadze, A.M. Kuznetsov and co-authors) is a good example for that. ...

Еще в разделе: (Показать все результаты (>61) - electr003.chem.msu.ru/ )

• Veronika K. Laurinavichyute overflow
• Boris B. Damaskin

... Инновационная . структура МГУ . ... деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... In the commercial world, the business manager (entrepreneur, Chief Executive Officer (CEO), Chief Operating Officer (COO):) must create the infrastructure and face many issues specific to the establishment and development of a new company. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>23) - innovation.msu.ru/ )

About BAFIZ . BAFIZ at SINP MSU . ... The main aims of the Project at SINP of MSU . ... Development of the Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE) at SINP of MSU . Development of the tools for Space Physics data utilization and processing . ... The communication infrastructure base of the Project at SINP of MSU is based on Radio-MSU Network . The computational base of the Project at SINP of MSU is Computing Center ALPHA . ...

Еще в разделе: (Показать все результаты (>17) - dbserv.sinp.msu.ru/ )

• Satellite Informations Sector
• ULYSSES Online Data Set Selector