Arthropoda Selecta 11 (3): 173175 ї ARTHROPODA SELECTA, 2002 Arietellus acutus a new species of Copepoda (Calanoida: Arietellidae) from the southwestern Indian Ocean Arietellus acutus, новый вид копепод (Calanoida: Arietellidae) из юго-западной части Индийского океана Athea K. Heinrich А.К. Гейнрих P.P. Shirshov Institute of Oceanology, Russian Academy of Sciences, Moscow 117851 Russia. ... New species Arietellus acutus is described below. segmented, terminal spines of Exp segment 3 of various length. ...

Еще в разделе: (Показать все результаты (>987) - zmmu.msu.ru/ )

• http://zmmu.msu.ru/files/images/spec/Russ%20Ent%20J/ent20_1%20109_112%20Gavryushin%20for%20Inet.pdf
• Global fossil bat records - abstract
• Order Chiroptera

... E-journal. Public Administration" was first published online in 2003. ... International serial number of the magazine is ISSN 2070-1381 . ... Founding organization: Federal State Budgetary Institution of Higher Professional Education Lomonosov Moscow State University . Publisher: School of Public Administration, Lomonosov Moscow State University . The goal of E-journal. ... 119991, Room A-710, Shuvalovskiy building, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>236) - ee-journal.spa.msu.ru/ )

... Guidelines for Paper Submission . ... The program committee will schedule both oral and poster sessions. The abstract and summary of both oral and poster papers are published in the same manner in the Conference Program and the Technical Digest on CD-ROM. ... Oral Sessions . ... Poster Sessions . ... For poster sessions, authors are provided with bulletin boards on which to display their papers, along with a sign indicating their paper numbers, and pushтАУpins or adhesive tape. ... Program . ...

Еще в разделе: (Показать все результаты (>9) - iconolat13.phys.msu.ru/ )

• Invited speakers

... A.V.Burlakov, M.V.Chekhova, O.V.Karabutova, D.Yu.Korystov, Yu.B.Mamaeva and S.P.Kulik, Interference of Biphoton Fields. Laser Physics (2001) - в печати. ... Phys.Rev.A, 64, 041803 (4 стр) 2001. ... 2001). ... 86, ?20, 4710 (2001). ... Д.Ю.Кoрыстов, С.П.Кулик, А.Н.Пенин. ... Письма в ЖЭТФ 73, 248-252 (2001). ... A.V.Burlakov, M.V.Chekhova, D.N.Klyshko, S.P.Kulik, A.N.Penin, D.V.Strekalov and Y.H.Shih, Interference Effects in Spontaneous Two-photon Parametric Scattering from Two Macroscopic Regions. ...

Еще в разделе: (Показать все результаты (>94) - qi.phys.msu.ru/ )

• Sergei Kulik: Scientific interest

... Composing of New Materials Using the Method of Self-Propagating High-Temperature Synthesis in Presence of Ultrasonic Vibrations . ... One of the promising techniques of the manufacture of new materials with a wide complex of various properties is the method of self-propagating high-temperature synthesis (SHS). The essence of the SHS method lies in conducting the process in the regime of combustion due to exothermal reaction of components without the use of considerable external heating. ...

Еще в разделе: (Показать все результаты (>156) - acs366.phys.msu.su/ )

• Abstract (Invited)

About BAFIZ . BAFIZ at SINP MSU . ... The main aims of the Project at SINP of MSU . ... Development of the Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE) at SINP of MSU . Development of the tools for Space Physics data utilization and processing . ... The communication infrastructure base of the Project at SINP of MSU is based on Radio-MSU Network . The computational base of the Project at SINP of MSU is Computing Center ALPHA . ...

Еще в разделе: (Показать все результаты (>6) - dbserv.sinp.msu.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Рейтинг: 1378 . c] volatile objects accessing . ... Re: [c] volatile objects accessing [ re: genom ] . ... Re: [c] volatile objects accessing [ re: monoid ] . ... Рейтинг: . ...

Еще в разделе: (Показать все результаты (>2551) - www.snto-msu.net/ )

• Intl money transferring/custom clearance process payments - Public forum of MSU
• Вопрос про synchronisation/concurrency (в .NET) - Public forum of MSU united
• CDemu 1.1.0 Release - Public forum of MSU united student networks

This section of library contains information about "classic" Star Catalogs. ... For a Henry Draper Catalog 272149 stars have received a total of 531,211 identifications in 7 сatalogs: . 270456 - in Astrographic Catalogue ( "Carte du Ciel", 4M), . 251943 - in Guide Stars Catalog (GSC), . ... A file with information on the components of 1788 of multiple systems in catalog HDEC (3681 component, or a combination thereof, with 4054 recording). ... A file with information about 21971 variable stars. ...

Еще в разделе: (Показать все результаты (>8) - astrometric.sai.msu.ru/ )

... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...

Еще в разделе: (Показать все результаты (>5) - www.bio.msu.ru/ )

• Master In Nanobiotechnology ? Биологический факультет МГУ

... Academic Programmes . ... For Teachers . ... Vestnik CIE (in Russian) . ... Russian Teachers Training Programmes . ... The Center provides teacher training in the field of Russian as a foreign language to enhance the efficiency and effectiveness of the instructional process. ... We offer lessons on methodology of teaching Russian as a foreign language. ... The course of professional retraining (1 2 semesters) for getting a new qualification: Teacher of Russian as a foreign language is offered. ...

Еще в разделе: (Показать все результаты (>24) - www.cie.ru/ )

• Russian Language Programmes :: Academic Programmes :: CIE

4 SPIN. ... 0 1 Hello, world! ( ) ";" , active proctype main() { printf("Hello, world!\n") } ­ , >spin hello.pml Hello, world! 1 process created Hello, world! ... mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( turn == P) - printf( Produce\n ); turn = C od } active proctype consumer() { do :: ( turn == C) - printf( Consume\n ); turn = P od } ( 1) ­ 0, (op on sequence) (guard) ­ mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( ...

Еще в разделе: (Показать все результаты (>3) - savenkov.lvk.cs.msu.su/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Reports on progress and error are always recorded in the log file of the program. ... UT date of the measurement finish in YYYY-MM-DD format UT time of the measurement finish in hh:mm:ss format Average flux in A aperture Average flux in B aperture Average flux in C aperture Average flux in D aperture Normalized variance of flux in A aperture Normalized variance of flux in B aperture Normalized variance of flux in C aperture Normalized variance of flux in D ...

Еще в разделе: (Показать все результаты (>23) - curl.sai.msu.ru/ )

• . The . MASS . Group .

Vladimir Feldman (Moscow U) Q: How can we purify water using solvated electron? ... However, they cannot help, when we deal with some very important toxic contaminations, which are not readily oxidized (heavy metal ions, chlorinated compounds, etc.) ... The examples of these reactions were given shown in lecture. ... Indeed, irradiation of water with fast electrons produces both strong oxidizer (OH radical) and very efficient reducing species (hydrated electron) in nearly balanced amounts. ...

Еще в разделе: (Показать все результаты (>18) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/qnazmutdinov.pdf
• http://www.elch.chem.msu.ru/mole/lecture/qsavinova.pdf

... 2013/04/16 - 11:59am . Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Site map . Site search . MSU website . ... This site (RSS) . E -mail: info@hsmi.msu.ru . Phone: +7 495 932-80-73 . Fax: +7 495 932-80-73 . 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>7) - hsmi.msu.ru/ )

• School overview | MSU Higher school of management and innovation

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

137. http://dist.ffl.msu.ru/cdo/conf0606/confaneng.doc

138. http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%202.pdf

139. http://www.chem.msu.ru/eng/misc/babaev/papers/030e.pdf

140. "Sbr process specialist for lg chem, korea" - вакансия в разделе "Работа для