... ACAT'2003 : IX INTERNATIONAL WORKSHOP ON ADVANCED COMPUTING AND ANALYSIS TECHNIQUES IN PHYSICS RESEARCH (ACAT03), 1-5 December, 2003, Tsukuba, Japan. ... Advanced Statistical Methods for Data Analysis Traditionally, researchers from high energy and nuclear physics together with experts in computer science take part in the ACAT series of workshops. ... Thus, researchers from these and other fields are welcome to join us in discussions on modern computing techniques and ways for new developments. ...

Еще в разделе: (Показать все результаты (>67) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/matousek/ACAT2002_Matousek.pdf
• http://acat02.sinp.msu.ru/presentations/GGtut/Dev-05-Communication1.pdf
• http://acat02.sinp.msu.ru/InfoBull1.txt

... Number of required sensors is 10000 4 The part of ANTARES collaboration (http://antares.in2p3.fr/Collaboration/index.html) 5 The some direction of MSU group activity in the project · Bioluminescence cut · Quality cuts · SN search 6 Bioluminescence cut We have collected distributions of hit counts for each PMT during one K40 run (~45min) Usually these distributions consist of 2 parts ­ Poissonian (due to K40 and plankton ... Conclusion Bioluminescence cut was done. ...

Еще в разделе: (Показать все результаты (>23) - antares.sinp.msu.ru/ )

• ANTARES в МГУ
• ANTARES in MSU

... About CIE MSU . ... Student's Life . ... About Moscow University . ... Lomonosov Moscow State University . ... About Lomonosov Moscow State University . Lomonosov Moscow State University is the oldest and largest classic university in Russia. ... Every year over 40 thousand students study at the MSU, over 5 thousand are foreign students from 80 countries. ... Foreign students undergo training at the Center for International Education before entering the main faculties of the MSU. ... Students? ...

Еще в разделе: (Показать все результаты (>18) - www.cie.ru/ )

• L?Universit? d?Etat de Moscou (MGU) :: CEI

... Научные семинары . ... расписание семинаров . семинар 1 . ... Отчет о семинаре || ... This talk will focus on one of the emerging technology for solar light conversion into electricity; the dye-sensitized solar cell. ... The present lecture will give a general background to the solar energy field with a focus on dye-sensitized solar cells. ... С докладом Dye-sensitized Solar Cells Materials and Interfaces выступил профессор Lars Kloo из Королевского технологического института г. Стокгольма. ...

Еще в разделе: (Показать все результаты (>48) - nano.msu.ru/ )

• Dye-sensitized Solar Cells ? Materials and Interfaces | MSU Nanotechnology
• Forthcoming seminars. Condensed Matter Physics | Научно-образовательный центр
• Forthcoming seminars. Condensed Matter Physics | MSU Nanotechnology Education

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• About

... MOIP (Moscow Society of Naturalists) is a unique social phenomenon in Russia?s life. ... Great scientists and thinkers such as academicians V.I. Vernadskiy and N.D. Zelinskiy presumed that MOIP acted in Moscow as the Academy of Sciences up to the Saint-Petersburg (Russian) Academy moving to the capital in the thirties of 20 th century. In the course of all these years, the Moscow Society of Naturalists united and coordinates almost all scientific potencies in the sphere of natural science. ...

Еще в разделе: (Показать все результаты (>4) - www.moip.msu.ru/ )

Title Author Key words Inequality in the era of globalization: essence, institutions, regional specificity and dynamics Osipova N.G. social inequality, era of globalization, ideology of globalism, agents of globalism, institutions of globalism, neo-liberal values, global inequality, regional characteristics of global inequality, sociology The paper examines the problems of social inequality in the era of globalization. ... Sociology possibilities in softening of an existing inequality are considered. ...

Еще в разделе: (Показать все результаты (>34) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2011/2/06.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/2/07.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/3/09.pdf

... The Institute is staffed wit h a team of 15 experts involving 6 Ph.D programs including ap plied mathematics, theor etical ph ysics, technolog y for computer applications, signal and information processing and bi ochemical, collab orating wit h experts in p hysiolog y, biolog y, iatrolog y, etc. and sp eci all y engaged in t he research of Human Brain Project and neuro- infor matics. ... Chinese Ph ysics , Jovrnal of Optics, Chinese Ph ysics Letter. ...

Еще в разделе: (Показать все результаты (>152) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/science/psyrussia/2009/presidium.pdf
• Psychology in Russia. State of the Art. Editorial Board

... The Council on Complex Problems of Cosmic Rays of the Russian Academy of Sciences and the Skobeltsyn Institute of Nuclear Physics (SINP) of Lomonosov Moscow State University are planning to held a workshop "Cosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century" on May 16-18 2011 at the Moscow State University. ... The Workshop banquet will be held on Tuesday, May 17 th . ... Workshop тАЬCosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century"...

Еще в разделе: (Показать все результаты (>8) - tunka.sinp.msu.ru/ )

30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...

Еще в разделе: (Показать все результаты (>3) - cosrad.sinp.msu.ru/ )

• http://cosrad.sinp.msu.ru/experiments/tus/doc/Ponce2007fin.pdf

Generale Information . ... Students . ... Scientific Work . ... Department of Lithology and Marine Geology unites two laboratories: Laboratory of Lithology and Facial Analysis and Laboratory of Marine Geology , there is a branch in Geological Institute of Russian Academy of Sciences . The training of the students is carried out on educational direction 011100 "Geology", the department lets out the bachelors and diplomaed experts in specializations 011104 "Lithology" and 011105 "Marine Geology". ...

Еще в разделе: (Показать все результаты (>124) - www.geol.msu.ru/ )

• Faculty of Geology >> Departments
• Faculty of Geology >> Geology at Moscow State University
• Links of engineering geophysics and software

... Другие выступления . ... Short and long distance homing in the marsh frog, Rana ridibunda Pallas // RIN08: Orientation & Navigation. ... We investigated pond search orientation of the Marsh frog (Rana ridibunda Pall.) in the populations of the west of Moscow region near Zvenigorod Biological station of Moscow State University, near the town of Kharabali in Astrakhan region and near the village Maliy Utrish in Krasnadar region. ... Научная работа * Другие выступления . ...

Еще в разделе: (Показать все результаты (>64) - vertebrata.bio.msu.ru/ )

• Student Reports at International Conferences
• Leaders of the Department
• Tatyana A.Ilyina

... Phone: (007) 095-9395197; fax: (007) 095-9395888; e-mail: e@lav01.sinp.msu.ru . ... The term of training - 1-2 years. ... Physics of quark-gluon mesons spectroscopy? ... Scientific chief - Ludmila Ivanovna Sarycheva, professor of the Chair of Cosmic Rays and Physics of Cosmos and leader of Laboratory of Hadron Interactions of SINP MSU senior science researcher, PhD. ... Simultaneously the problem of the solar cosmic ray flare energetic electron sources in the interplanetary space will be studied. ...

Еще в разделе: (Показать все результаты (>38) - foroff.phys.msu.ru/ )

• Postdoctoral training (Neutronography)
• International Collaboration
• Papers of our group

. L EONID G LADILIN , ZEUS and ATLAS experiments . Home institute: SINP MSU, Moscow . Address: . Dr. Leonid Gladilin . Experimental High Energy Physics Lab. Skobeltsyn Inst. of Nuclear Physics . Moscow State University . Leninskie gory, GSP-1, 1(2) . Moscow 119991, Russia . Tel : +7 495 939 3568 , FAX: +7 495 939 3064 . Address in DESY: . Dr. Leonid Gladilin . DESY, ZEUS experiment . Notkestr. 85 . 22607 Hamburg . Germany . Tel: +49 40 8998 3957, Fax: +49 40 8998 3092 . Back to my Home page .

Еще в разделе: (Показать все результаты (>7) - lhe.sinp.msu.ru/ )

• Information for our Guests

... In vitro, the protein S7 of Thermus thermophilus is able to form complexes with both the minimal 16S rRNA fragment and the intercistronic region of the str operon mRNA from E.coli (Kd = 1.4x10-7 M and 1.1x10-7 M respectively). ... The filter binding assay. ... The most striking result of our study is that thermophilic protein S7 binds strongly to the E.coli S12-S7 intercistronic region of str mRNA in vitro, inspite of the lack of the functionally analogous thermophilic extended region. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2003.pdf
• http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/nar2004.pdf

... Custom Query . ... Component . ... automata io requirements ui . ... And љ Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . Or љ Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . ... Summary Component Milestone Status Owner Type Priority Resolution Created Modified Blocked By Blocking Reporter Keywords Cc . ...

Еще в разделе: (Показать все результаты (>9) - kodomo.cmm.msu.su/ )

• Custom Query в?' Cyclyc Cell Automata

... You can receive guidance from the NIST Library Daemon (nistlibd@cmr.ncsl. nist .gov) by sending email to: nistlib@cmr.ncsl. nist .gov The email message should, for starters, just read: send index Below is the type of email you'll receive from the NIST Library Daemon: (Message 18N, 82 lines, 3495 bytes) From nistlibd@cmr.ncsl. nist .gov Sat Jun 26 19:49:04 1993 Received: from CMR.NCSL ...

Еще в разделе: (Показать все результаты (>217) - www.parallel.ru/ )

• MPI_Wtick | PARALLEL.RU - Информационно-аналитический центр по параллельным
• MPI_Wtime | PARALLEL.RU - Информационно-аналитический центр по параллельным
• FFTW - Footnotes | PARALLEL.RU - Информационно-аналитический центр по

... 2015 . ... Ph.D., associate professor, P.A. Stolypin Volga Region Institute, Russian Presidential Academy of National Economy and Public Administration. ... The article analyzes Russian regional practice of the governmental support of civil society institutions. ... The author argues the expediency of a public policy in the field of support of civil society institutions in the regions of the Russian Federation. ... Public policy, civil society institutions, target program approach. ...

Еще в разделе: (Показать все результаты (>204) - ee-journal.spa.msu.ru/ )

Nuclear Instruments and Methods in Physics Research B 161+163 (2000) 748+752 www.elsevier.nl/locate/nimb Characterization of Dyrrhachium silver coins by micro-PIXE method I. Uzonyi a a,* , R. Bugoi b, A. Sasianu c, A.Z. Kiss a, B. Constantinescu b, M. Torb agyi d Department of Electrostatic Accelerators, Institute of Nuclear Research of the Hungarian Academy of Sciences (ATOMKI), P.O. Box 51, Bem ter 18/c, 4001 Debrecen, Hungary b Cyclotron Laboratory, Institute of Atomic Physics ... Nucl. ...

Еще в разделе: (Показать все результаты (>82) - hbar.phys.msu.ru/ )

... Seminar archive . ... Seminar archive 2012 14 September . ... The VLT Survey Telescope: a year after its coming into operation" . ... The VLT Survey Telescope (VST) is a 2.6 m wide field optical telescope located at the Cerro Paranal Observatory of ESO in the Chilean Andes. ... VST features an active optics system which guarantees an overall instrumental resolution of 0.5 arc-seconds over a field of view of 1 x1 , with only marginally elongated images. ... All seminars: . ...

Еще в разделе: (Показать все результаты (>307) - master.sai.msu.ru/ )

• SAI Space Monitoring Laboratory