... Head of Analytical Chemistry Division, Department of Chemistry, Lomonosov Moscow State University. Principal researcher, Kurnakov Institute of General and Inorganic Chemistry, RAS. ... 1950-1955 - student of Department of Chemistry, Lomonosov Moscow State University. ... Since 1978 - professor of Analytical Chemistry Division, Department of Chemistry, Lomonosov Moscow State University; since 1989 - head of the Division (half time). ... USSR State Prize (1972) . ... Moscow State University . ...

Еще в разделе: (Показать все результаты (>47) - analyt.chem.msu.ru/ )

• Лаборатория Электрохимических Методов

... Do those millions of sites and services provide useful information, or are they just "information pollution"? ... Abstract This is a review of electrochemical information and services available on the internet, and some evaluation of their usefulness for professionals, students, and the general public. ... Two examples are the "Internetchemistry" site [26] and the "Electrochemical Science and Technology Information Resource (ESTIR)", which lists over 1,000 links to electrochemistry-related sites [7]...

Еще в разделе: (Показать все результаты (>80) - electr003.chem.msu.ru/ )

• Department of Electrochemistry
• Laboratory of Electrical Double Layer and Electrode Kinetics
• Frumkin Institute, Theoretical Department

Добро пожаловать на Lizard.phys.msu.su! ... Phys Rev Lett | J Appl Phys | Appl Phys Lett | Semicond Sci Technol . Science | ... J Phys CM | ... J Phys Chem Sol | ... phys status solidi | ... J Phys Soc Jpn | Jpn J Appl Phys | Int Mater Rev | J Low Temp Phys | J Comput Phys | Proc Natl Acad Sci USA . SIAM J Appl Math | ... NATO Sci | ... SunSITE USA | ... CNN-Weather: Moscow | Tver' Weather Forecast | Moscow Weather Forecast . ... Computer science. ...

Еще в разделе: (Показать все результаты (>15) - lizard.phys.msu.su/ )

... hall in front of room 01, MSU, Main Building . ... room 01, MSU, Main Building . ... Silvia Chelala (Empire State College, State University of New York, Old Westbury, New York, USA) Designing and Teaching Introductory Spanish as a Foreign Language at a Distance . ... FFL, recreation hall, 3rd floor . ... FFL, room 519 . ... FFL, room 501 . ... FFL, . room 107-108 . ... Internet-Supported Teaching . ... FFL, room 106 . ... FFL, room 416 . ... FFL, room 420 . ... FFL, room 210 . ...

Еще в разделе: (Показать все результаты (>12) - anazarenko.ffl.msu.ru/ )

• Факультет иностранных языков и регионоведения МГУ. Центр дистанционного

Introduction to condensed matter physics . ... Physics of semiconductors . ... Computers in experimental physics of semiconductors . ... Physics of semiconductor devices . ... The course deals with the main physical principles of functioning and design of various semiconductor devices. ... Techniques of semiconductor doping and methods of semiconductor parameters control. ... Experimental studies of energy spectra of various semiconductors by optical methods. ... Physics of Semiconductors division ...

Еще в разделе: (Показать все результаты (>78) - scon155.phys.msu.su/ )

• First-principles calculations of physical properties of crystals
• Irina A. Sluchinskaya
• Theory of electronic properties of disordered semiconductors and systems with

This module is obsolete. ... This module is contained in the mod_dld.c file, and is not compiled in by default. It provides for loading of executable code and modules into the server at start-up time, using the GNU dld library. ... Note: that DLD needs to read the symbol table out of the server binary when starting up; these commands will fail if the server can't find its own binary when it starts up, or if that binary is stripped. ... Module: mod_dld . ... Syntax: LoadModule module filename . ...

Еще в разделе: (Показать все результаты (>54) - neptun.sai.msu.ru/ )

• Anatoly V. Zasov
• Manual Page: dbmmanage - Apache HTTP Server
• Apache module mod_so

. УЧЕБНЫЕ МАТЕРИАЛЫ ОН-ЛАЙН . Веб-портал по атмосферным наукам : . Интерактивные модули объединенной образовательной программы по оперативной метеорологии COMET (UCAR) . Лекции учебного курса по метеорологии Европейского центра среднесрочных прогнозов погоды (ECMWF) . ЖУРНАЛЫ ОН-ЛАЙН . AGU Journals - JGR - Oceans . AMS Journals Online . Boundary-Layer Meteorology . CFD Resources Online - Homepage Database . Cornell University Library . CRC Press LLC . CUP Journals On Line . Ecology and Society . Elsevier

Еще в разделе: (Показать все результаты (>6) - geophys.srcc.msu.ru/ )

Sergey Vladimirovich Petrushanko Afflilation and official address: Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow State University Leninskiye Gory, Moscow 119991, Russia E-mail: sergeant@mail.cern.ch Date and place of Birth: 24 March 1975, Sverdlovsk (USSR) Citizenship: Russian Federation Education: 2002 Ph.D. (High energy physics ) Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow ...

Еще в разделе: (Показать все результаты (>48) - lav01.sinp.msu.ru/ )

• Home Page of Strong Interactions Laboratory
• Vladimir L. Korotkikh

... Foundation of Physics Group University of Bari (headed by Professor Augusto Garuccio, garuccio@fisica.uniba.it), Department of Physics, Bari, Italy; . ... University of Geneva, Group of Applied Physics, Division of Optics (headed by Professor Nicolas Gisin, Nicolas.Gisin@physics.unige.ch). Joint INTAS project; . ... National University of Singapore, Faculty of Science, Department of Physics (headed by Professor C. Oh) and Laboratory of Quantum Information (headed by Professor Arthur Ekert). ...

Еще в разделе: (Показать все результаты (>120) - qi.phys.msu.ru/ )

• About us :: Quantum Information Laboratory

About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...

Еще в разделе: (Показать все результаты (>3) - textbook.sinp.msu.ru/ )

Вы посетили: conf_engl.html . ... International Algebraic Conference dedicated to 70th birthday of professor A.V. Mikhalev, Russia, Moscow, November 2010 . ... International Algebraic Conference dedicated to the 100-year anniversary of professor A.G. Kurosh, Russia, Moscow, May 2008 . ... 2nd International Conferences on Matrix Methods and Operator Equations, Russia, Moscow, July 2007 . ... staff/guterman/conf_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>19) - halgebra.math.msu.su/ )

• staff:guterman:conf_rus.html | Кафедра высшей алгебры
• staff:guterman:activ_rus.html | Кафедра высшей алгебры

POLARITY RULES IN COMPUTER DESIGN OF HETEROCYCLES E.V. Babaev Chemical Dept, Moscow State University, Moscow 119899, Russia Abstrac t Qualitative polarity rules for heterocyclic ring synthesis via polar reactions of cyclization or recyclization are discussed. The main idea is the application of general definition of consonant and dissonant structures to acyclic chains and cyclic heteroaromatics and analysis of interconversion of this two combinatorial properties. ...

Еще в разделе: (Показать все результаты (>102) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/030e.pdf
• Семинар "Перспективные наноматериалы"
• CURRICULUM VITAE

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/fasta.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out