... Большая часть материала была собрана на Звенигородской биостанции (ЗБС) МГУ на мухоловке-пеструшке ( Ficedula hypoleuca ) . ... С. 31-32. [скачать pdf-файл] . ... С. 278-295. [скачать pdf-файл] . ... Bushuev A.V., Ivankina E.V., Kerimov A.B, 2003. Factors influencing resting metabolic rate of Pied Flycatcher fledglings (Ficedula hypoleuca Pallas) // Vogelwarte (Abstract Volume 4 th Conference of the European Ornithologists' Union. ... Bushuev A.V., Ivankina E.V., Kerimov A.B., 2006. ...

Еще в разделе: (Показать все результаты (>42) - vertebrata.bio.msu.ru/ )

• Sergei V. Ogurtsov

Estimation of selection pressure on degenerate sequences in genomes: choice of method I.S. Rusinov,1 A.S. Ershova, 1 2,3,4 A.S. Karyagina, 2,3,4 S.A. Spirin, 1,2,5 A.V. Alexeevski 1,2,5 Lomonosov Moscow State University, Faculty of Bioengineering and Bioinformatics, Moscow 119992, Russia;2Lomonosov Moscow State University, Belozersky Institute of Physical and Chemical Biology, Moscow 119992, Russia; 3Gamaleya Institute of Epidemiology and Microbiology, ...

Еще в разделе: (Показать все результаты (>98) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/128.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/19.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/48.pdf

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

Ledneva R.K., Alekseevskii A.V., Vasil'ev S.A., Spirin S.A., Kariagina A.S. Structural aspects of interaction of homeodomains with DNA . Molecular Biology (Moscow) 2001, 35 (5):647?659 [ SpringerLink ] . ... Anna S. KARYAGINA, Andrei V. ALEXEEVSKI, Andrei V. GOLOVIN, Sergei A. SPIRIN, Olga V. VOROB'EVA, Elena A. KUBAREVA. ... Biophysics (Moscow) , vol. ... Ershova A.S., Alexeevski A.V., Spirin S.A., Karyagina A.S. Common structural features of homeodomains and homeodomain-DNA complexes. ...

Еще в разделе: (Показать все результаты (>17) - monkey.belozersky.msu.ru/ )

Institute of Mechanics , . Lomonosov Moscow State University , . ... Phone: +7 495 939 2039 . Fax: +7 495 939 0165 . E-mail: mailybaev imec.msu.ru . ... Mathematics . stability theory and dynamical systems . ... Physics and Mechanical Engineering . ... Engineering Faculty, University of l'Aquila, Italy . ... Department of Engineering Mechanics, Dalian University of Technology, China . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>19) - mailybaev.imec.msu.ru/ )

... 2009 .) ... 1 Trade Justice Movement. http://www.tjm.org.uk [on-line] [cited 14 June 2008]; Make Poverty History. http://www.makepovertyhistory.org [on-line] [cited 29 July 2008]; Oxfam. http://www.oxfam.org.uk/ [on-line] [cited 22 June 2008]; World Development Movement. http://www.wdm.org.uk/about/index.htm [on-line] [cited 22 December 2008]; Jubilee Debt Campaign. http://www.jubileedebtcampaign.org.uk/ [on-line] [cited 16 June 2009]. ... http://www.un.org/ru/ [on line] [cited 14 November 2008]. . ...

Еще в разделе: (Показать все результаты (>6378) - hist.msu.ru/ )

• CEH Publications
• Moscow State University. Faculty of History. Frequently Asked Questions
• History of Russia. Electronic resources

... Reliable records of solar and lunar eclipses go back as far as 750 B. C. They bear on such questions as whether the sun is shrinking or the earth is not spinning as fast as it once did . ... On the second only the records of total solar eclipses since the 18th century are pertinent. ... Whether a given solar eclipse is total or annular (with a bright ring of sun surrounding the disk of the moon) depends on the position of the moon in its elliptical orbit. ... TOTAL: "ENTIRE SUN ECLIPSED" . ...

Еще в разделе: (Показать все результаты (>88) - hbar.phys.msu.ru/ )

• Autobiography of Joseph Scaliger
• Age Determinations by Radiocarbon Content: Checks with Samples of Known Age
• newtrev2.htm

... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...

Еще в разделе: (Показать все результаты (>2) - vmu.phys.msu.ru/ )

... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...

Еще в разделе: (Показать все результаты (>8) - vernov-relec.sinp.msu.ru/ )

Warning : oci_connect(): ORA-12543: TNS:destination host unreachable in / home / swx / public_html / models / sw_forecast.php on line 3 Warning : oci_parse() expects parameter 1 to be resource, boolean given in / home / swx / public_html / models / sw_forecast.php on line 4 Warning : oci_execute() expects parameter 1 to be resource, null given in / home / swx / public_html / models / ...

Еще в разделе: (Показать все результаты (>8) - swx.sinp.msu.ru/ )

• http://swx.sinp.msu.ru/models/get_charea.php

The Energy Spectrum of Primary Cosmic Rays by the Data of Tunka Cherenkov Array . S.V.Bryanski, Y.V.Vasilchenko, O.A.Gress, T.I.Gress, G.N.Dudkin, A.I.Klimov, V.S.Khlytchieva, L.A.Kuzmichev, B.K.Lubsandorzhiev, E.A.Osipova, V.N.Padalko, L.V.Pan'kov, Yu.A.Parfenov, P.G.Pochil, V.V.Prosin, Yu.A.Semeney . Proc. 24th ICRC, Roma, 1995, v.2, p.724 . The First Results of TUNKA-13 EAS Cherenkov Light Experiment . ... Tunka EAS Cherenkov Array - status 2001 . ... 1) SINP MSU, Moscow, Russia . ...

Еще в разделе: (Показать все результаты (>9) - dbserv.sinp.msu.ru/ )

• The Other BAFIZ Pages
• BAFIZ

MultiTest V.1.2, a program to binomially combine independent tests and performance comparison with other related methods on proportional data Thierry De MeeШs1,2*, Jean-FranГois GuИgan2 and Anatoli Teriokhin3 1 IRD, UMR 177 IRD-CIRAD "Trypanosomoses", Centre International de Recherche-DИveloppement sur l'Elevage en zone Subhumide (CIRDES), 01 BP 454, Bobo-Dioulasso 01, Burkina-Faso. ... All procedures more or less behaved consistently with ~5% significant tests at ?= ... and number of species in | ...

Еще в разделе: (Показать все результаты (>30) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Dimorph_HumBiol.pdf
• Персональные страницы

... Nevertheless, in mammals and in other intron-rich organisms, many of the SSs often involve nonconsensus (Nc), rather than consensus (Cn), nucleotides, and beyond the two critical nucleotides, the SSs are not perfectly conserved between species. ... GBE exon intron exon intron exon Acceptor splice site Consensus Nonconsensus -24-23-22 -21-20-19-18-17-16 -15-14-13-12 -11-10 -9 -8 -7 -6 -5 -4 -3 -2 -1 +1 Position number -3 -2 Donor splice site -1 +1 +2 +3 Position number +4 +5 +6 FIG.1.- ...

Еще в разделе: (Показать все результаты (>10) - storage.bioinf.fbb.msu.ru/ )

• Roman Sutormin. Home Page

Подписка на рассылку обзоров astro-ph на Subscribe.Ru . ... Новый рентгеновский пульсар в остатке сверхновой . ... Верное и неверное в данных Hipparcos . ... Из раздела physics . ... Обзоры препринтов astro-ph . ... Comments: 8 pages, 5 figures; proceedings of a workshop on Stellar End Product, to appear in MmSAI (expected to be 2006, volume 77, number 1) . ... Comments: Accepted for publication by A , 18 pages, 23 figures . ... Comments: 31 pages, 13 figures, review paper for Astrophysics Update 2 . ...

Еще в разделе: (Показать все результаты (>412) - astro.uni-altai.ru/ )

• Astronomy links
• Новости науки

Lomonosov Moscow State University . ... About Us . ... Further Education Programs . ... General Information . ... The Department of Linguistics and Information Technologies . ... The Department of Linguistics and Information Technologies was founded in 2008. ... The latest publication (?21, June 2012, 'Information Technology in Linguistics') was about the Fifth International Scientific and Methodological Conference 'ICT in Linguistics, Foreign Language Teaching and Intercultural Communication'. ...

Еще в разделе: (Показать все результаты (>65) - ffl.msu.ru/ )

... Published: 08 September 2014 . Dear second-year students, let me congratulate you on the beginning of the new academic year! ... First class will be on September 5 2014, at 17:05, N8. Sergey Yakovlev is the teacher. " 8-bit microcontrollers ". First class will be on September 9 2014, at 17:05, 3-14 (KNO). Vladimir Bruevich is the teacher. ... Alexander Karabutov and Yuriy Rumyantsev are the teachers. ... Anatoliy Sizov is the teacher. Introduction to Linux ".љ ...

Еще в разделе: (Показать все результаты (>17) - engineering.phys.msu.ru/ )

• Mitsubishi Electric met our laboratory
• Meeting with the representatives of Argentine
• Participation in INNOPROM-2015

Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...

Еще в разделе: (Показать все результаты (>16) - innovation.msu.ru/ )

... Homocysteine and its derivatives as possible modulators of neuronal and non-neuronal cell glutamate receptors in Alzheimer's disease. ... Homocysteine (HC) and its derivatives may be involved in the etiology of Alzheimer's Disease (AD), although the precise mechanisms by which these compounds could cause cellular pathology are still unclear. ... These effects may contribute to the neuronal pathology and immunosenescence that occur in AD. ...

Еще в разделе: (Показать все результаты (>210) - biochem.bio.msu.ru/ )

• Biochemistry Department of Moscow State University | Special curses
• Biochemistry Department of Moscow State University | Education
• Biochemistry Department of Moscow State University | Site map

... Head of the Department of Emission-line Stars and Galaxies of SAI MSU . ... Structure and kinematics of galaxies . ... Strasburg Database . Hubble Telescope Archive . ... CFHT Archive . ... Chinese evolutionary synthesis Yunnan . Korean evolutionary synthesis Yonsei . Evolutionary synthesis database BaSTI . ... Electronic Journal "New Astronomy" . Electronic Astrophysical Journal . Electronic Astronomical Journal . ... Questions and comments send to Olga Sil'chenko olga@sai.msu.su ...

Еще в разделе: (Показать все результаты (>44) - sn.sai.msu.ru/ )

• Recent publications

... Соавтор - Урусов В.С. 2. ... C. 720-729 Соавтор - Урусов В.С. 4 Mixed anionic framework in the structure of Na2{MnF[PO4]} Печатн Acta Cryst. ... 15 Crystal structure of K2[Cu3ZnF(PO4)3], a new mixed zinc copper phosphate Печатн Eur. ... Соавторы - Масса В., Пеков И.В., Кучериненко Я.В. 28 Layer structure of NH4[Co(PO4)H2O] Печатн Acta Cryst. ... Соавторы - Соболева А.А., Масса В, Димитрова О.В., Урусов В.С. 63 Hillite, a new member of the fairfieldite group: description and crystal structure Печатн....

Еще в разделе: (Показать все результаты (>25) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/literature/2008.php
• http://cryst.geol.msu.ru/literature/2008.php/