... Учебные отделения и программы . ... Программы подготовки на факультете . ... Поступление иностранных граждан . ... Полезные ссылки . ... 107-108 ФИЯР состоится научно-практический семинар "MSU and EF Research Collaboration Enhancing Language Learning and Teaching". ... Dr Bernard Shearer, Head of English First in Russia (based in Moscow): Overview of English First and discussion of the different initiatives for teaching a variety of populations (young learners, teenagers, government, Olympics, etc.)...

Еще в разделе: (Показать все результаты (>117) - ffl.msu.ru/ )

• About Us

... to Composite Mechanics Chair. was based at Mechanical & Mathematical Department in 1987. ... Address: Composite Mechanics Chair, Mechanical & Mathematical Department, Moscow State University, Moscow 119899, Russia. ... The Department of the Composites Mechanics was found at the Faculty of Mechanics and Mathematics of Lomonosov Moscow State University (MSU) in 1987. ... Optimisation of numerical methods in Solid Mechanics . Application of asymptotical methods in Composites Mechanics . ...

Еще в разделе: (Показать все результаты (>3) - composite.msu.ru/ )

• INTAS 95-525 Final Reprort (Short version)

... K. Potzger, "Ion beam based doping and defects for tailoring magnetic properties", PNI workshop "Magnetism and highly correlated electron systems", 11.6.- ... M. Butterling, W. Anwand, S. Cornelius, K. Potzger, A. Smekhova, M. Vinnichenko, A.Wagner, "Investigations of defects in magnetic TiO2 using a slow-positron-beam", Abstract Book of the 16th International Conference on Positron Annihilation (ICPA16), University of Bristol, United Kingdom, 19-24 August 2012, p.150 (2012) 3. ... 7540-7544 (2012)...

Еще в разделе: (Показать все результаты (>30) - magn.phys.msu.ru/ )

• http://magn115.phys.msu.ru/Rus/DETI2/smekhova.html
• http://magn115.phys.msu.ru/Rus/DETI2/AnnoRusPart2012.pdf

... О проекте . ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... The layout of beam-lines and experimental stations intended for the applications of the X-ray laser-electron generator to the investigation of the elemental composition, material structure and biological objects is discussed. ...

Еще в разделе: (Показать все результаты (>9) - miles.sinp.msu.ru/ )

• Thomson Electron X-Ray Source for Medical Applications | Проект ЭЛЛАРИ

Joint Design of Micrometeoroid/Orbital Debris Impact Shield and Development of Failure Risk Assessment System for Orbital Spacecraft Nikolay G. Chechenin1, Peijie Li 1 2 Skobeltsyn Institute of Nuclear Physics Lomonosov Moscow State University 2Tsinghua University Space Debris Growth http://www.nasa.gov/pdf/582393main_OCT-Orbital_Debris_TAGGED.pdf January 26, 2016 2nd China-Russia Joint Space Science Project Proposals ...

Еще в разделе: (Показать все результаты (>115) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/pci2012/vecher29_2.pdf
• http://danp.sinp.msu.ru/pci2015/utro_stend_28.pdf
• СОДЕРЖАНИЕ журнала Поверхность

NEW ECONOMIC SCHOOL .. BSP/2007/094 R 2007 " " .. ... On The Dynamics of People's Unions / Working Paper # BSP/2007/094 R. - Moscow, New Economic School, 2007. - 19 p. (Rus.) ... Key words: public economics, allocation theory, size of nations ISBN ї .. ... x[0,1] - (FOC) FOC: (W1 (x) + W2 (1 - x)) = 0, x (1) - (SOC) SOC: 2 (W1 (x) + W2 (1 - x)) 0. x2 (2) , (1) (2), .. ... Grossman & Mendoza, 2001, 2004) , , , : , . ... On the Number and Size of Nations", Quarterly Journal of Economics Vol. ...

Еще в разделе: (Показать все результаты (>11) - belyakov.imec.msu.ru/ )

• http://belyakov.imec.msu.ru/papers/SPbGTU2003.pdf

Backlinks to FamFamFamFlagIcons in System Web ( Search all webs ) . ... FamFamFamContrib Usage The icons are attached to the FamFamFamFlagIcons FamFamFamMiniIcons FamFamFamMintIcons FamFamFamSilkIcons FamFamFamSilkCompanion1Icons .. NEW - 04 Sep 2011 - 18:45 by ProjectContributor . ... FamFamFamFoswikiExtras So far built by Foswiki:Main.SvenDowideit based on the Silk ones above, except for 1 the XML icon which comes from http://commons.wikimedia .. ... Containing a large variety of icons, you .. ...

Еще в разделе: (Показать все результаты (>2097) - wiki.cs.msu.ru/ )

• (backlinks in all Webs) FamFamFamContrib < System < Foswiki
• (backlinks in System Web) FamFamFamContrib < System < Foswiki
• (backlinks in all Webs) FamFamFamFlagIcons < System < Foswiki

List of Publications . ... Odoulov S,Tarabrova T, Shumelyuk S, Naumova II, Chaplina TO: Photorefractive response of bulk periodically poled LiNbO 3 :Y:Fe at high and low spatial frequencies. ... Evlanova N.F., Naumova I.I., Chaplina T.O., Blokhin S.A. and Lavrishchev S.V. Periodically poled Y:LiNbO 3 single crystal: impurity distribution and domain wall location, Journal of Crystal Growth, Vol. 223, ? 1-2, pp 156-160 (2001). ... Phys. Rev. Lett., 86, pp 4021-402 (2001). ...

Еще в разделе: (Показать все результаты (>6) - newcryst.phys.msu.ru/ )

• Search of novel crystalline materials

... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...

Еще в разделе: (Показать все результаты (>37) - ferro.phys.msu.ru/ )

• Physics Faculty of Moscow State University.
• Physics Department of Moscow State University
• Special courses for the students of Physics Faculty, specialized at the...

... The mo del is a directed dyadic acyclic graph. ... New vertexes are added one by one. The probability of this addition dep ends on the structure of existed graph. ... 4 (2 ) FIGURE 4: The probabilities of different variants to add a new vertex to the future in the step number 500. pij is the probability to add a new vertex to the outgoing external edges numbers i and j . Similarly, p is the probability to add a new vertex to the incoming external edges numbers and . ...

Еще в разделе: (Показать все результаты (>24) - temporology.bio.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/krugly_the-dinamics.pdf
• http://temporology.bio.msu.ru/EREPORTS/krugly_discreet-mechanics.pdf
• http://temporology.bio.msu.ru/EREPORTS/krugly_amplitudes.pdf

Statistics in Morse theory of smo oth functions Vladimir I. Arnold Steklov Mathematical Institute, Moscow, Russia e-mail: arnold@mi.ras.ru There are exactly 17746 topologically distinct Morse functions with 4 saddles on the two dimensional sphere. This result basing on combinatorics of random graphs was obtained only two years ago within an investigation of Hilbert's 16th problem on topological classification of polynomials in real algebraic geometry. ...

Еще в разделе: (Показать все результаты (>30) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/Kozlov.pdf
• http://pont2008.cs.msu.ru/files/en/abstracts/VasilievaButuzovNefedov.pdf

... Understanding Attitudes and Predicting Social Behaviour. ... Bandstatter, H. (1993). Should Economic Psychology care about personality structure? Journal of Economic Psychology, 14(3), 473-494. Berthoud, R., and Kempson, E. (1990). ... Journal of Economic Psychology, 11(4), 545-556. ... British Journal of Social Psychology, 28, 159-171. ... Journal of Economic Psychology, 14(2), 337-376. ... The Economic Mind: The social psychology of economic behaviour. ... The Social Psychology of Aging. ...

Еще в разделе: (Показать все результаты (>14) - psyberlink.flogiston.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>20) - mouse.genebee.msu.ru/ )

• ConClus

... Menzerath's Law for Morphemic Structures of Words: . A Hypothesis for the Evolutionary Mechanism of its Arising and its Testing . Anatoliy A. Polikarpov . ... Key words: Menzerath's Law, morphemic structures, language evolution . ... In this paper there is present (1) a hypothesis for understanding the evolutionary mechanism responsible for the Law arising and (2) some data for testing the hypothesis. ... A Hypothesis. ... Altmann, G. Prolegomena to Menzerath's Law//Glottmetrika 2. ...

Еще в разделе: (Показать все результаты (>71) - old.philol.msu.ru/ )

• MSU-LGCLL:: Anatoliy A.Polikarpov - Semasiological and Word-formational
• Melnikov G.P.- Systemology and Linguistic Aspects of Cybernetics
• MSU-LGCLL:: Papers submitted to QUALICO-94

... Институт . ... Студентам . Приветствуем вас на Официальном сайте Русско-германского института науки и культуры. Published by admin on April 6, 2016 under Новости . ... No Comments ? ... 09.00 - 15.30 љ љљ 736 - 1.ГУМ . ... Морозова Е.Б. пн. љ17-00? 18-30, 18-45?20-15, 20-30?21-15љ 1 к., ауд.736 1 ГУМ . ... Башкиров В. М. вторник 15.00-17.00, четверг љ15.00-17.00, 1 ГУМ ауд.736 . вторник 17.00-19.00, пятница 17.00-19.00 1 ГУМ ауд.736 . ... 736 1 Гум) . ... 7361 Гум) . ... December 2011 . ...

Еще в разделе: (Показать все результаты (>2) - rgi.msu.ru/ )

Ботанический сад МГУ участвует в новом проекте Европейского союза 'INQUIRE', который направлен на развитие интереса к науке у школьников и широкое внедрение в образовательные системы европейских стран (общего и дополнительного образования) новых образовательных технологий и методов обучения (IBSE), основанных на развитии внеклассной научной проектно-исследовательской деятельности школьников (LOC- Learning Outside the Classroom). ... Ботанический сад Московского государственного университета (Россия) . ...

Еще в разделе: (Показать все результаты (>14) - botsad.msu.ru/ )

Sum of Squares of polynomials technique for stability and bounds in fluid dynamics S. Chernyshenko (Imperial College London) and P. Goulart (ETH Zurich) This talk will introduce a new method for proving global stability of fluid flows using recently developed optimization methods based on sum-of- squares (SOS) decomposition to construct a polynomial Lyapunov function. ... Such polynomial functions can be searched for efficiently using the SOS technique. ...

Еще в разделе: (Показать все результаты (>36) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2006/CD/BozhkoAAPutinGF.doc
• http://hit-conf.imec.msu.ru/2006/CD/BozhkoAAPutinGF.pdf
• http://hit-conf.imec.msu.ru/2012/lectures/Yakhot-abstract.doc

... This applet generates an observing list based on an observer's location and time. ... To use this program, enter in your location, and the local times at which you wish to begin and end observing. The date you enter should correspond to the calendar day at the time at which you begin observing. For example, if you wish to observe from 9:37 PM October 23, 2007 until 3:21 AM October 24, 2007, you would enter 21:37 for the starting time, 03:21 for the finish time, and 10/23/2007 for the date. ...

Еще в разделе: (Показать все результаты (>46) - observ.pereplet.ru/ )

• MASTER GLOBAL ROBOTIC TELESCOPES NET

... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...

Еще в разделе: (Показать все результаты (>4) - ged.chem.msu.ru/ )

Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . ... Research . ... Laboratory of Micro- and Nanofluidics . ... Professor B.V.Derjaguin moved to the Laboratory with his research group as an Emeritus Professor. ... In 1993 Professor Olga I. Vinogradova took over the leadership of the Laboratory. In 2009 the Laboratory of Micro- and Nanofluidics was organized by Professor Olga I. Vinogradova at the Physics Department of the M.V.Lomonosov MSU. ...

Еще в разделе: (Показать все результаты (>60) - nanofluidics.phys.msu.ru/ )

• Lobaskin
• Teaching