Russian . Selected publications of V. Zakharov 2015 . Zakharov V.S., Perchuk A.L., Zavyalov S.P., Sineva T.A., Gerya T.V. Supercomputer Simulation of Continental Collisions in Precambrian: The Effect of Lithosphere Thickness // Moscow University Geology Bulletin. ... P. 77–83. doi: 10.3103/S014587521502012X. Paper (pdf) . ... Paper (pdf) . ... Summary in English . ... DOI: 10.3103/S014587521101011X. Paper (pdf) . ... Paper (pdf) Summary in English . ... Page design: ©V.Zakharov . ...

Еще в разделе: (Показать все результаты (>31) - dynamo.geol.msu.ru/ )

• Summaries of articles

miniSTRY OF HEALTHCARE AND SOCIAL DEVELOPMENT RF NORTHERN RESEARCH CENTER NORTH-WEST BRANCH RAMS federal service for hydrometeorology and environment monitoring (rosgidromet) MINISTRY OF HEALTHCARE AND SOCIAL DEVELOPMENT OF ARKHANGELSK REGION territorial administration of federal service for consumers' rights protection Surveillance and human well-being in arkhangelsk region NORTHERN STATE MEDICAL UNIVERSITY [pic] NEWSLETTER of the All-Russian Science-and-Practice ...

Еще в разделе: (Показать все результаты (>31) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2014_1.doc
• http://www.antropos.msu.ru/vestnic/e2013_4.doc

University Satellites and . Space Science Education . ... Subjects of collective training courses and teaching seminars concern with particular stages of development of the remote sensing methods of research. 6 teaching seminars organized at the base of Moscow University to the middle of 1990's were devoted to: - interpretation of multiband aerospace images ; computer interpretation of aerospace images ; remote sensing and geoinformatic; educational GIS;. space images in school ...

Еще в разделе: (Показать все результаты (>6705) - cosmos.msu.ru/ )

• Space Scientific and Education project of Lomonosov Moscow State University
• University Satellites and Space Science Education '2006 I

This page is devoted to information on Supernova 1999gi in NGC 3184 . ... Information on the original web pages for many of these images can be found on the Supernova links web page. ... NGC 3184 is a fairly close Mag 10.3 galaxy, only about half as distant as the Virgo cluster. ... Seiichi Yoshida has a 1999gi page . Odd Trondal's 1999gi page . ... CfA image . ... 14.5 . ... Jean Marie Llapasset image . ... vsnet-alert 3805 ] SN 1999gi in NGC 3184 . vsnet-chat 2438 ] Host galaxy of SN1999gi . ...

Еще в разделе: (Показать все результаты (>474) - www.rochesterastronomy.org/ )

• Supernova 1999cq in UGC 11268
• Bright Supernova Bright Supernova
• Supernova 1999bg in IC 785

... Using the CFBDSIR wide field survey for brown dwarfs, we identified CFBDSIRJ214947.2-040308.9, a late T dwarf with atypically red J-Ks colour. ... SN 2009ip in NGC 7259 Electronic Telegram No. ... 7.09, [19.0; 2009 Aug. ... Accepted for publication in MNRAS Subjects: High Energy Astrophysical Phenomena (astro-ph.HE) The jet opening angle theta_jet and the bulk Lorentz factor Gamma_0 are crucial parameters for the computation of the energetics of Gamma Ray Bursts (GRBs). ...

Еще в разделе: (Показать все результаты (>217) - master.sai.msu.ru/ )

... English: ps (gzipped) 9 pages . arXiv.org e-Print archive: http://arXiv.org/abs/math.CO/0109122 . Abstract. ... Topological charge of the real periodic finite-gap sine-Gordon solutions. ... arXiv.org e-Print archive: http://arXiv.org/abs/math-ph/0111039 . ... English: ps Russian: ps 5 pages . ... A note on the real fermionic and bosonic quadratic forms: their diagonalization and topological interpreation. ... arXiv.org e-Print archive: http://arXiv.org/abs/math-ph/0110032 . ...

Еще в разделе: (Показать все результаты (>142) - higeom.math.msu.su/ )

• Publications (Russian)
• Knots (English)
• INVITED ADDRESSES:

... Vrzhesh P.V., Zaitsev S.V., Kurochkin I.N., Varfolomeev S.D. Internal and external immobilization of chloroplasts. ... Eremenko A.V., Uvarova I.S., Kurochkin I.N. Influence of tetrehydrocannabinol on the receptor and physical and chemical properties of rat brain membrane. ... Eremenko A.V., Mineeva M.F., Chernov S.F., Kurochkin I.N. Tyrosine hydroxylase activity in the two-dimensional monomolecular films. ... Russian)., ... Ivnitckiy D.M., Kurochkin I.N., Varfolomeev S.D. Electrochemical biosensors....

Еще в разделе: (Показать все результаты (>156) - www.enzyme.chem.msu.ru/ )

• Information Division
• Biosensor Research Group
• Группа Биосенсоров

... DVM system . DVM-system - home page . DVM-system is designed to support development of portable and efficient parallel computational applications for different architecture computers. The C-DVM and Fortran-DVM languages based on the same model are used. ... Predictor of DVM-program performance . ... DVM-system is ised on workstations (SGI, SUN, HP, IBM) and personal computers with OS UNIX and WINDOWS 95/NT. ... MVS-1000/16 (KIAM of RAS and IMM of RAS) . ... Download DVM-system . ...

Еще в разделе: (Показать все результаты (>118) - sp.cs.msu.ru/ )

• Заседание научно-исследовательского семинара. 25 декабря 2002 г.

pic] [pic] AGREEMENT on cooperation between the Network of Universities from the Capitals of Europe (UNICA) and All-Russia Non-Government Organization The Russian Rectors ' Union (RRU) Based upon understanding of the priority role of Higher Education Institutions in global processes of forming knowledge-based world economy and society; the fundamental principle of university education - studies, science and ... of the Russian Rectors' Union, |of the Network of Universities | ...

Еще в разделе: (Показать все результаты (>57) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/88.doc
• http://www.rsr-online.ru/doc/2011_03_29/6.pdf
• http://www.rsr-online.ru/doc/norm/174.doc

. Наземные станции . Оборудование . Текст о наземных спутниковых станциях, которые использует сеть Радио-МГУ, будет здесь несколько позже.

Еще в разделе: (Показать все результаты (>3) - www.radio-msu.net/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

... education . ... Composite materials . Materials for solar and fuel cells . ... Registration deadline is 30 April 2012. ... New deadline is 15 May 2012 . ... Registration fee should be paid before 10 June 2012. ... For information please contact Mrs. Olga Bogomolova: obogomol@gmail.com and Dr. Alexander Chertovich: chertov@polly.phys.msu.ru . ...

Еще в разделе: (Показать все результаты (>17) - nano.msu.ru/ )

• Schools | MSU Nanotechnology Education and Research Center

The Laboratory of the Historical Information Science . ... The historical information science laboratory was founded within the structure of the source studies department on 8 December 1995 for the purpose of fulfilling the decision of the academic council of the History Faculty of 4 October 1991 about the transformation of a group for the application of mathematic methods and mainframes in historical research in the laboratory of historical information sciences. ... Senior laboratory assistant (2) . ...

Еще в разделе: (Показать все результаты (>366) - www.hist.msu.ru/ )

• Editions

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

135. Магистратура ВМК МГУ - подготовка ERP-программистов, консультантов SAP

136. Index of /~oxana/prac/task2/.svn/text-base

137. List of Publications Naumova

138. Research interests

139. http://www.psy.msu.ru/people/krivitsky/krivitsky2007.pdf

140. http://www.msm.biophys.msu.ru/archive/doc14950/eng.pdf