P.V.Korolenko, N.N.Fedotov, V.F.Sharkov. Main properties and potential practical applications of M-mode lasers. ... T.I.Arsenyan, P.V.Korolenko, E.A.Kuliagina, N.N.Fedotov. ... T.I.Arsenyan, N.N.Fedotov, L.S.Kornienko, P.V.Korolenko, E.A.Kulyagina, G.V.Petrova Laser beams with helical wavefront dislocations and their applications in the diagnostical and metrological systems. // 5-th International Conference "Industrial Lasers and Laser Applications '95" (Shatura, Moscow reg., ...

Еще в разделе: (Показать все результаты (>7) - optics.sinp.msu.ru/ )

List of Publications . ... Odoulov S,Tarabrova T, Shumelyuk S, Naumova II, Chaplina TO: Photorefractive response of bulk periodically poled LiNbO 3 :Y:Fe at high and low spatial frequencies. ... Evlanova N.F., Naumova I.I., Chaplina T.O., Blokhin S.A. and Lavrishchev S.V. Periodically poled Y:LiNbO 3 single crystal: impurity distribution and domain wall location, Journal of Crystal Growth, Vol. 223, ? 1-2, pp 156-160 (2001). ... Phys. Rev. Lett., 86, pp 4021-402 (2001). ...

Еще в разделе: (Показать все результаты (>5) - newcryst.phys.msu.ru/ )

• Search of novel crystalline materials

Moss D., Sokoloff D., Resonances for activity waves in spherical mean field dynamos, eprint arXiv:1211.2414, 6 pages, 6 figures, 2012. We study activity waves of the kind that determine cyclic magnetic activity of various stars, including the Sun, as a more general physical rather than a purely astronomical problem. We try to identify resonances which are expected to occur when a mean-field dynamo excites waves of quasi-stationary magnetic field in two distinct spherical layers. ...

Еще в разделе: (Показать все результаты (>75) - srcc.msu.ru/ )

• D.Moss, D.Sokoloff, Seed fields for galactic dynamos, Astron. Astrophys.
• Volodin E. M., Yurova A.Yu. Summer temperature variability, skewness and
• Leading scientific fellow Sergey Piskarev Ph.D.

for CMS Collaboration) Sergey Petrushanko Elliptic flow studies in heavy-ion collisions using the CMS detector 14th Lomonosov Conference on Elementary Particle Physics 19-25 A ug us t 200 9 1 Elliptic flow in non-central heavy-ion events transverse plane py ) px Kolb P.F., Heinz U., nucl-th/0305084 Initial spatial anisotropy results in elliptic flow of finite particles. ... CMS Calorimeters ECAL and HCAL HYDJET generator was used to simulate PbPb events at the LHC. ...

Еще в разделе: (Показать все результаты (>111) - nuclphys.sinp.msu.ru/ )

• JLab September 10 Meeting
• Unveiling of the bust in memory of N.N.Bogolliubov at the Conference Hall of

... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...

Еще в разделе: (Показать все результаты (>15) - imk.msu.ru/ )

... 2, 1998 UNEXPECTED RECYCLIZATION OF PYRIDINIUM SALTS TO GIVE OXAZOLES E. V. Babaev and A. A. Tsisevich N-(Acylalkyl)-2-halopyridinium salts (I) are commonly used in the synthesis of azolopyridines with a bridging nitrogen atom. In particular, the formation of imidazo[l,2-a]pyridines and their N-alkyi- and N-aryl derivatives in the reaction of salts I with ammonia and primary amines [1, 2] or aromatic amines [1] is well known. ... Reactions of salts I with secondary amines have not been reported. ...

Еще в разделе: (Показать все результаты (>123) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/117e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/017e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/040e.pdf

Elena V. Stenina . ... Department of Electrochemistry . ... Thesis: "Two-dimensional condensation of organic substances at electrode/solution interface and its role in electrochemical kinetics" . ... Junior Scientific Researcher, Senior Teacher, Senior Scientific Researcher, Leading Scientific Researcher, Department of Electrochemistry, Chemistry Faculty of Lomonosov Moscow State University . ... Investigation of adsorption at electrode/ solution interface and influence on electrochemical reactions". ...

Еще в разделе: (Показать все результаты (>82) - electr003.chem.msu.ru/ )

• Boris I. Podlovchenko: Selected Publications
• Jurii M. Maksimov: Selected Publications
• Liana N. Sviridova: Selected Publications

trendence Graduate Barometer Europe 2011 About the survey ­ About trendence trendence Graduate Barometer Europe is an annual online student survey which allows students to express their opinion on topics re lated to career and education. ... Ulrike Heyne Project Manager trendence Graduate Barometer Europe 2011 About the survey Facts and benefits How does it work? ... If your students take part in the trendence Graduate Barometer, they will receive an exclusive Student Report. ...

Еще в разделе: (Показать все результаты (>3) - studsov.math.msu.su/ )

... Smurova KM, Alieva IB, Vorob'ev IA. Free and centrosome-attached microtubules: quantitative analysis and themodeling of two-component system. ... Genes Cells. ... Mimori-Kiyosue Y, Grigoriev I, Lansbergen G, Sasaki H, Matsui C, Severin F, Galjart N, Grosveld F, Vorobjev I, Tsukita S, Akhmanova A. CLASP1 and CLASP2 bind to EB1 and regulate microtubule plus-end dynamics at the cell cortex. J Cell Biol. ... Cell Biol Int. 2004;28(2):139-50. ... Membr Cell Biol. 1997;11(2):195-211. in Russian . ...

Еще в разделе: (Показать все результаты (>32) - cellmotility.genebee.msu.ru/ )

• Cell Motility Lab

General Information . ... Local Information . ... The city represents great cultural value because in the late 19th and early 20th centuries, Kislovodsk as a fashionable spa attracted many musicians, artists, and members of the Russian aristocracy. ... Double room with full pension (breakfast, lunch, dinner) - 2620 rubles per person per night. solnechniy . ... Citizens of most countries need visa to enter the Russian Federation. ... Victor Kornilov, Sternberg Astronomical Institute (chair) . ...

Еще в разделе: (Показать все результаты (>22) - site2010.sai.msu.ru/ )

• Methods and instruments to measure/monitor major site properties

... Why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ... BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ... Filters are used to remove low-complexity sequence because it can cause artifactual hits (please see Q: After running a search why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ...

Еще в разделе: (Показать все результаты (>132) - www.genebee.msu.ru/ )

• GeneBee BLAST 2.2.22+ Services Help
• GeneBee BLAST 2.2.8 Services Help
• Genebee BLAST 2.2.22+ Services Help

... Форумы > Разное > Тема . Автор темы Dr.Neurosurgus . Форумы Список тем Новая тема . ... Publication/Reference Managers . ... чем народ пользуется, чтобы не утонуть в базе ссылок по публикациям по своей теме? . не одними же Reference Manager и ProCite . ... http://forum.khamenya.ru . Ответить Цитировать . ... на сцайнтифике в general форуме . ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>76) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | Аспирантура в Порту, Португалия
• MMOnline | Форумы | Разное

Open Conference Systems . Conference Help . ... Conference Content Search . ... Conference Information . ... By Conference . ... Home > ICONO/LAT 2016 > Intl. Conf. on Coherent and Nonlinear Optics/Intl. Conf. on Lasers, Applications, and Technologies . The leading event in the area of quantum electronics, laser physics, photonics and their applications. ... ICONO/LAT 2016 will be held in Minsk, the capital and largest city in Belarus, The oldest mentions of Minsk date back to 1067. ...

Еще в разделе: (Показать все результаты (>35) - hea.phys.msu.su/ )

• ICONO/LAT 2016
• Search

Вы посетили: arzhantsev_s_a_publications . ... История кафедры . ... On restriction of roots on affine T-varieties, Beitr?ge zur Algebra und Geometrie / Contributions to Algebra and Geometry 55 (2014), no. ... Journal of Pure and Applied Algebra 218 (2014), no. ... Сибирский математический журнал 53 (2012), вып.6, 1354-1372 . ... Математический Сборник 203 (2012), вып.4, 47-60 . ... staff/arzhantsev_s_a_publications.txt Последние изменения: 10.05.2015 22:32 От arjantse | ...

Еще в разделе: (Показать все результаты (>16) - halgebra.math.msu.su/ )

• staff:arzhantsev_publications | Кафедра высшей алгебры
• staff:guterman:inv_engl.html | Кафедра высшей алгебры
• staff:guterman:conf_engl.html | Кафедра высшей алгебры

Estimation of selection pressure on degenerate sequences in genomes: choice of method I.S. Rusinov,1 A.S. Ershova, 1 2,3,4 A.S. Karyagina, 2,3,4 S.A. Spirin, 1,2,5 A.V. Alexeevski 1,2,5 Lomonosov Moscow State University, Faculty of Bioengineering and Bioinformatics, Moscow 119992, Russia;2Lomonosov Moscow State University, Belozersky Institute of Physical and Chemical Biology, Moscow 119992, Russia; 3Gamaleya Institute of Epidemiology and Microbiology, ...

Еще в разделе: (Показать все результаты (>97) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/128.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/19.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/48.pdf

... About Journal | ... Sociology and Political Science publishes original works on sociology and political science, results of research and experiments in social and political spheres in Russia and abroad, methodological innovations, information about conferences, reviews of the recent books in sociology and political science. ... Please include full article title both in Russian and English. ... Information about the author/authors both in Russian and English. ... References. ...

Еще в разделе: (Показать все результаты (>18) - www.socio.msu.ru/ )

. Advanced Study Institute "Structure and Dynamics of Elementary Matter", . Kemer, Turkey, September 21 - October 2, 2003 . To Hadronic Interactions Laboratory Home Page . To Igor Lokhtin Home Page . Last update: October 3, 2003, Igor Lokhtin

Еще в разделе: (Показать все результаты (>47) - lav01.sinp.msu.ru/ )

• Vacation in Russalka, Bulgaria, September 5-19, 2003
• Vladimir L. Korotkikh
• Home Page of I. Lokhtin

New Series of Historical Publications from the MSU Press . In 1998, the History Faculty of Moscow State University inaugurated a new series of publications designed to promote the results of recent research efforts and the teaching experience of our Faculty members and Departments. It is our intention that with these editions a clearer understanding of the Faculty, its current research orientations and mission, may be communicated. ... New Series of Editions . ...

Еще в разделе: (Показать все результаты (>362) - www.hist.msu.ru/ )

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

Ledneva R.K., Alekseevskii A.V., Vasil'ev S.A., Spirin S.A., Kariagina A.S. Structural aspects of interaction of homeodomains with DNA . Molecular Biology (Moscow) 2001, 35 (5):647?659 [ SpringerLink ] . ... Anna S. KARYAGINA, Andrei V. ALEXEEVSKI, Andrei V. GOLOVIN, Sergei A. SPIRIN, Olga V. VOROB'EVA, Elena A. KUBAREVA. ... Biophysics (Moscow) , vol. ... Ershova A.S., Alexeevski A.V., Spirin S.A., Karyagina A.S. Common structural features of homeodomains and homeodomain-DNA complexes. ...

Еще в разделе: (Показать все результаты (>17) - monkey.belozersky.msu.ru/ )