Russian Language Training via INTERNET. Internet-based educational hypertexts: some results of formal approach. ... Comparative study of Internet-based educational curricula in Russian Phonetics was based upon formal criteria and objective evidence concerning: (1) coincidence of navigational patterns embedded in a web-presentation of course material to main cognitive patterns of students, (2) rate of hypertext optimisation, (3) adjustability to different academic syllabuses and educational modes. ...

Еще в разделе: (Показать все результаты (>390) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/main/people/kibrik-aa/cv.html
• МГУ :: Филфак :: ОТиПЛ
• LangueDOC :: Archives

HERMITE FUNCTIONS EXPANSION BASED NON-LOCAL MEANS ALGORITHM FOR CT-APPLICATIONS1 N. Mamaev2, A. Lukin3, D. Yurin4, M. Glazkova5, V. Sinitsin6 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia mamaev.nikolay93@mail.ru, 3lukin@ixbt.com, 4yurin@cs.msu.ru 5,6 Federal Center of Medicine and Rehabilitation Ivan'kovskoye sh., ... Noise in CT-images is close to Gaussian [3]. ...

Еще в разделе: (Показать все результаты (>15) - imaging.cs.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

Применение моделирования для изучения качества воздушной среды на примере различных сценариев урбанизации. ... Рассматривается влияние будущей планировки, определяющей развитие городской инфраструктуры, на состояние окружающей среды. Обычно, когда исследуется будущее влияние роста мобильных источников загрязнения, моделируется увеличение пробега транспортных средств, как функция роста численности населения. ...

Еще в разделе: (Показать все результаты (>27) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=15&from=&ref_ind=0325004220

... class applied_topology(ost.Topology.Abstract): #, # p1 self.edges[p1] # p2 p1 7 self.edges = { p1: [p1_1,...,p1_k1] p2: [p2_1,...,p2_k2] ... pM: [pM_1,...,p1_kM] } # p2 # , p1 def proximity(self, p1, p2): # in bool # self.edges[p1] p2 return p2 in self.edges[p1] 3.1.1.2. . class applied_topology(ost.Topology.Abstract): #, # p1 self.edges[p1] # p2 p1 self.edges = { p1: [p1_1,...,p1_k1] p2: [p2_1,...,p2_k2] ... pM: [pM_1,...,p1_kM] } # p # , p def neighborhood(self, p): return self.edges[p] . ...

Еще в разделе: (Показать все результаты (>6) - compmech.math.msu.su/ )

• A. Kh. Pergament - Computational Mechanics Department

Fundamental problems . ... Theory of plasticity based on the conception of the yield surfaces with the singular points (singular plasticity). ... Creep theory. ... Stability. ... Applied problems of solid mechanics: methods for solving boundary and initial problems. ... Methods of solving boundary value problems based on the theory of comlex variation functions and integral transformations in the theory of elasticity and heredity. ... Potential method in creep and relacsation materials problems. ...

Еще в разделе: (Показать все результаты (>89) - new.math.msu.su/ )

• Control problems: theory and applications | Department: General Problems of
• Международная культурная и научная конференция по механике

Nowadays one of the pronounced tendencies in the language policy (language plannin g) of all English-speaking countries is the development and wide spreading of the so-called inclusive language based on the principle of political correctness. ... 1990. ... Buffalo, 1995. . ... inclusive language). " " . ... father, son, son of man, man, brother .. he they. ... URL: http:/www.academia.org/lectures/lindl.html ( : 15.04.2008). ... URL: http://www.cbmw.org/Resources/Articles ( : 19.12.2011). , , , , , , . ...

Еще в разделе: (Показать все результаты (>118) - ffl.msu.ru/ )

• Наш факультет

... Larin A.V, Rybakov A.A., Zhidomirov G.M. Journal of Physical Chemistry C, 116, 2399-2410 (2012). ... Larin A.V, Rybakov A.A., Zhidomirov G.M., Mace A., Laaksonen A., Vercauteren D.P. Journal of Catalysis, 281, 212-221 (2011). ... A.A. Rybakov, A.V. Larin, G.M. Zhidomirov, D.N. Trubnikov, D.P. Vercauteren . ... A. A. Rybakov, E. D. Belega, and D. N. Trubnikov . Journal of Chemical Physics, 133, 144101 (2010) . ... The following article may be found on the site of Journal of Chemical Physics.) ...

Еще в разделе: (Показать все результаты (>20) - beams.chem.msu.ru/ )

• Сотрудники - Ларин Александр Владимирович

Backlinks to TwistyPlugin in System Web ( Search all webs ) . ... Foswiki Site Level Preferences This topic defines site level settings that apply to all users and webs on this site. ... NEW - 27 Feb 2011 - 17:25 by ProjectContributor . ... NEW - 06 Sep 2013 - 09:15 by ProjectContributor . ... Foswiki Release 1.0.10 08 Sep 2010 Foswiki The Free and Open Source Wiki Foswiki is an enterprise collaboration and information sharing tool targeted for professional .. ... Number of topics: 15 . ...

Еще в разделе: (Показать все результаты (>2074) - wiki.cs.msu.ru/ )

• (backlinks in all Webs) TwistyPlugin < System < Foswiki
• (backlinks in System Web) PatternSkinTheme < System < Foswiki
• (backlinks in all Webs) PatternSkinTheme < System < Foswiki

... education . ... Composite materials . Materials for solar and fuel cells . ... Registration deadline is 30 April 2012. ... New deadline is 15 May 2012 . ... Registration fee should be paid before 10 June 2012. ... For information please contact Mrs. Olga Bogomolova: obogomol@gmail.com and Dr. Alexander Chertovich: chertov@polly.phys.msu.ru . ...

Еще в разделе: (Показать все результаты (>30) - nano.msu.ru/ )

• Schools | MSU Nanotechnology Education and Research Center
• Fundamentals of Nanotechnology, 2009 | MSU Nanotechnology Education and
• Fundamentals of Nanotechnology, 2009 | Научно-образовательный центр по

... Форумы > Аспирантура > Тема . Автор темы ter . Форумы Список тем Новая тема . ... PhD positions in logic and AI, Vancouver (Canada) . PhD positions are available in the area of logic-based artificial intelligence. ... interested in logic (or discrete mathematics) and its uses for practical problem solving. ... Online application information is available at: . ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>6449) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | Аспирантура в США
• MMOnline | Форумы | Аспирантура | Аспирантура в Великобритании
• Програма конферецнии Topology, analysis and applications in mathematical

grdhisteq - Histogram equalization for grd files grdhisteq in _ grdfile [ -G out _ grdfile ] [ -C n _ cells ] [ -D ] [ -N [ norm ] ] [ -Q ] [ -V ] grdhisteq allows the user to find the data values which divide a given grdfile into patches of equal area. ... One could use grdhisteq to write to stdout an ASCII list of those data values which divide the range of the data into n _ cells segments, each of which has an equal area in the image. ... C Sets how many cells (or divisions) of data range to make. ...

Еще в разделе: (Показать все результаты (>614) - xray.sai.msu.ru/ )

• http://xray.sai.msu.ru/~polar/html/publications/method/e_art.ltx
• http://xray.sai.msu.ru/~polar/html/publications/method/pic.ltx
• Introduction

. This page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>62) - num-anal.srcc.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>4) - npidb.belozersky.msu.ru/ )

Open Conference Systems . ... Home > International Conference on Laser Application in Life Sciences (LALS-2014) . Ulm, Germany . ... 89081 Ulm, Germany . ... Ulm, DE . ... Following previous International Conferences on Laser Applications in Life Sciences (LALS), e.g. in Oulu, Taipei or Moscow, it is now our pleasure to invite you for LALS-2014 which will take place fromТљJune 29 th to July 2Тљ nd in "Edwin Scharff Haus" conferences center at Ulm/Neu Ulm (Germany) on the banks of the Danube river. ...

Еще в разделе: (Показать все результаты (>104) - hea.phys.msu.su/ )

• Search
• 2014 International Conference on Laser Applications in Life Sciences
• Conference Timeline and Information

Официальный сайт кафедры Математической теории интеллектуальных систем и . ... Сотрудники . ... Курсы и семинары :: Студенты и аспиранты Мазуренко И.Л. :: Публикации Мазуренко И.Л. :: Публикации учеников Мазуренко И.Л. Родился в 1973 году в г.Приозерск Карагандинской области. ... US patent application 20160005179. ... Aliseychik P.A., Mazurenko I.L., Letunovskiy A.A., Petyushko A.A., Kholodenko A.B. Image processor with evaluation layer implementing software algorithms of different precision . ...

Еще в разделе: (Показать все результаты (>125) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Ryjov Alexander Pavlovich
• Интеллектуальные системы :: Наука :: :: V international congress on
• Intelligent Systems :: MaTIS Chair :: Information

The subject of cybernetics is quickly growing and there now exists a vast amount of information on all aspects of this broad-based set of disciplines. ... The fields of application are virtually unlimited and applications are discovered in the investigation or modelling of any complex system. The most obvious applications have been in the construction of artificially intelligent systems, the brain and nervous system, and socio-economic systems. ...

Еще в разделе: (Показать все результаты (>77) - old.philol.msu.ru/ )

• HUMLANG - announcements
• Using Markov Chains for Identification of Writers
• Using Literal and Grammatical Statistics\\ for Authorship Attribution

Division of Experimental and Theoretical Physics . ... Theory of gauge fields and its applications to elementary particle physics . Unified theory of physical effects and phenomena in systems of particles with electromagnetic interaction . ... Methods of Lobachevsky geometry in non-linear problems of mathematical physics . ... Interaction of ultra-short laser pulses with matter, investigations of physical properties of new materials for quantum- and optoelectronic systems . ... Materials science . ...

Еще в разделе: (Показать все результаты (>49) - foroff.phys.msu.ru/ )

• Admission Regulation
• Offered courses
• Scientific research at the Faculty of Physics

... Twenty five years ago the first Russian papers dedicated to Surface Nonlinear Optics were published. This 25th anniversary allows us to look back on the early 1980s, the time of appearance of Surface Nonlinear Optics as a branch of Optics. Pioneering works by Prof. Y.R. Shen in the early 1980s, which were based on the 1960s fundamental ideas of Prof. N. Bloembergen, stimulated an explosion of such studies at Moscow State University and around the world. ... March 2008 ...

Еще в разделе: (Показать все результаты (>35) - shg.phys.msu.ru/ )