... Большая часть материала была собрана на Звенигородской биостанции (ЗБС) МГУ на мухоловке-пеструшке ( Ficedula hypoleuca ) . ... С. 31-32. [скачать pdf-файл] . ... С. 278-295. [скачать pdf-файл] . ... Bushuev A.V., Ivankina E.V., Kerimov A.B, 2003. Factors influencing resting metabolic rate of Pied Flycatcher fledglings (Ficedula hypoleuca Pallas) // Vogelwarte (Abstract Volume 4 th Conference of the European Ornithologists' Union. ... Bushuev A.V., Ivankina E.V., Kerimov A.B., 2006. ...

Еще в разделе: (Показать все результаты (>50) - vertebrata.bio.msu.ru/ )

• Sergei V. Ogurtsov
• Student Reports at International Conferences
• Выступления студентов и аспирантов на конференциях

.

Еще в разделе: (Показать все результаты (>5) - lab110.imec.msu.ru/ )

Lomonosov Moscow State University . ... About Us . ... Further Education Programs . ... General Information . ... The Department of Linguistics and Information Technologies . ... The Department of Linguistics and Information Technologies was founded in 2008. ... The latest publication (?21, June 2012, 'Information Technology in Linguistics') was about the Fifth International Scientific and Methodological Conference 'ICT in Linguistics, Foreign Language Teaching and Intercultural Communication'. ...

Еще в разделе: (Показать все результаты (>64) - ffl.msu.ru/ )

• International Students
• Иностранным гражданам

NMW survey overview . Access image archive . ... The New Milky Way survey aims to detect bright (V<13.5) optical transients near the Galactic plane using an automated wide-field (8x6 deg.) system capable of surveying the whole Milky Way area visible from the observing site in one night. ... All images obtained during the transient search survey are available online (please use the image archive access form ). ... Images per field: . ... Images per night: . ... Milky Way imaging time: . ...

Еще в разделе: (Показать все результаты (>2) - scan.sai.msu.ru/ )

Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...

Еще в разделе: (Показать все результаты (>14) - sbmg.geol.msu.ru/ )

• Departement of Regional Geology and Earth History

... MSU Chamber Orchestra . ... 2001/2002 season: . ... Concert Hall of Sheremetev's Palace . ... Lidia Davydova, music director . MSU CHAMBER ORCHESTRA . Alexander Konstantinov, music director . ... Metro station "VDNH" . ... Сoncerto e-moll, for violin and strings . ... Сoncerto g-moll, for cello and strings . ... Music from "The Fairy Queen" . Metro station "Universitet", buses # 1, 113, 119, 661 (station "Dom kultury MGU"). ... P.I. Chajkovsky Concert Hall . ... The Early Music Theatre . ...

Еще в разделе: (Показать все результаты (>3) - music.genebee.msu.su/ )

P.V.Korolenko, N.N.Fedotov, V.F.Sharkov. Main properties and potential practical applications of M-mode lasers. ... T.I.Arsenyan, P.V.Korolenko, E.A.Kuliagina, N.N.Fedotov. ... T.I.Arsenyan, N.N.Fedotov, L.S.Kornienko, P.V.Korolenko, E.A.Kulyagina, G.V.Petrova Laser beams with helical wavefront dislocations and their applications in the diagnostical and metrological systems. // 5-th International Conference "Industrial Lasers and Laser Applications '95" (Shatura, Moscow reg., ...

Еще в разделе: (Показать все результаты (>9) - optics.sinp.msu.ru/ )

• Zagedan

... Data . ... Coronas-F . ... Solar energetic particles . ... Particle spectra at LEO . ... Spatial distributions of electrons with the energy 300-600 keV measured onboard CORONAS-F (2004-2005 years) and тАЬUniversitetsky-TatyanaтАЭ (2005-2006 years) satellites. Spatial distributions (geographical map) of trapped, quasi-trapped and precipitated electrons with the energy 300-600 keV measured on board CORONAS-F satellite in evening-night MLT sectors. ...

Еще в разделе: (Показать все результаты (>27) - smdc.sinp.msu.ru/ )

... Master Education . Second Education . ... Entrance requirements . ... personal statement addressed to the rector of MSU, containing the post-graduate course title and masters? program name . ... All applicants for full-time course (Russian students, both on scholarship and contract) are subject to following examinations: . ... All applicants to evening courses take an oral examination in the field of expertise. ... Второе высшее образование: second_edu@cs.msu.ru, 6-й этаж, комната 640, тел. ...

Еще в разделе: (Показать все результаты (>17) - hcs.cmc.msu.ru/ )

Schedule : Nonlinear Acoustics of the Atmosphere, the Ocean, and the Earth . ... Nonlinear Models of Waves in Granulated Partially Wet Media . ... Petukhov M. The Parametric Generation of Magnetic-Acoustic-Gravity Waves in an Atmosphere . ... Kovalevsky V. V. Modeling of the Process of Interaction of Infrasonic Acoustic and Seismic Waves . ... Kovalevsky V. V. Mathematical Problems of Generation and Interaction of Acoustic and Seismic Waves From Vibrational Sources . ...

Еще в разделе: (Показать все результаты (>100) - acs366.phys.msu.su/ )

• Abstract
• Schedule : Nonlinear Acoustics and Flows, Instabilities, Turbulence, and
• Schedule : Devices and Industrial Applications of Nonlinear Acoustics

... MTEL-2/RELEC (Telescope T) Instrument: Data Format Current Status . ... BE KNA RELEC . ... PSA-SAS3-Relec instrument, data format current status . ... Radio frequency waves diagnostic on RELEC satellite . ... First results ultraviolet and infrared radiation detector testing on board of the RELEC microsatellite . ...

Еще в разделе: (Показать все результаты (>8) - vernov-relec.sinp.msu.ru/ )

Institute of Mechanics , . Lomonosov Moscow State University , . ... Phone: +7 495 939 2039 . Fax: +7 495 939 0165 . E-mail: mailybaev imec.msu.ru . ... Mathematics . stability theory and dynamical systems . ... Physics and Mechanical Engineering . ... Engineering Faculty, University of l'Aquila, Italy . ... Department of Engineering Mechanics, Dalian University of Technology, China . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>25) - mailybaev.imec.msu.ru/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>10) - iconolat13.phys.msu.ru/ )

• Guidelines

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...

Еще в разделе: (Показать все результаты (>2) - vmu.phys.msu.ru/ )

... Journal of Virology [J Virol] . Common information . ... 1098-5514 . ... since 1967-01-01 till today . ... subscription - $1260,single article - $1 . ... biology ->virology . ... http://jvi.asm.org/ . ... 1967-01-01 . today . ... http://jvi.asm.org/contents-by-date.0... 1993 . ...

Еще в разделе: (Показать все результаты (>133) - journals.genebee.msu.ru/ )

The Energy Spectrum of Primary Cosmic Rays by the Data of Tunka Cherenkov Array . S.V.Bryanski, Y.V.Vasilchenko, O.A.Gress, T.I.Gress, G.N.Dudkin, A.I.Klimov, V.S.Khlytchieva, L.A.Kuzmichev, B.K.Lubsandorzhiev, E.A.Osipova, V.N.Padalko, L.V.Pan'kov, Yu.A.Parfenov, P.G.Pochil, V.V.Prosin, Yu.A.Semeney . Proc. 24th ICRC, Roma, 1995, v.2, p.724 . The First Results of TUNKA-13 EAS Cherenkov Light Experiment . ... Tunka EAS Cherenkov Array - status 2001 . ... 1) SINP MSU, Moscow, Russia . ...

Еще в разделе: (Показать все результаты (>9) - dbserv.sinp.msu.ru/ )

• The Other BAFIZ Pages

... RAMPA - CASE for portable parallel programs development?. ... N.A. Konovalov, V.A. Krukov, S.N. Mihailov and A.A. Pogrebtsov. Fortran DVM - a Language for Portable Parallel Program Development? ... Fortran DVM - A Language for the Development of Portable Parallel Programs. ... Development of Portable Program System for Modeling Neutron-Physical Processes in Nuclear Reactor on Parallel Computers. ... C-DVM-A Language for the Development of Portable Parallel Programs. ...

Еще в разделе: (Показать все результаты (>89) - sp.cs.msu.ru/ )

• Lib-DVM. Interface description
• DVM debugger. Detailed design. Part 4

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>2) - bioinf.fbb.msu.ru/ )

... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...

Еще в разделе: (Показать все результаты (>34) - ferro.phys.msu.ru/ )

• Department of General Physics and magneto-ordered matter. Physics Faculty of
• Physics Faculty of Moscow State University.
• Laboratory of Ferroelectricity