... ZOO is a flexible and powerful content application builder to manage your content. ... ZOO moves from simply being a CCK to an Application Builder. Apps are extensions for ZOO which are optimized for different purposes and types of content catalogs. ... A flexible and powerful content application builder to manage your content. Download ZOO . ... escort beylikduzu bayan escort escort bayan escort escort istanbul escort bayan porno film escort istanbul escort beylikduzu escort bayan ...
Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...
... Scientific goals . Cosmic rays of extremely high energy . ... Magnetospheric particles and radiation conditions . ... Scientific equipment . ... An attempt to register cosmic rays of extremely high energy of ~10 19 -10 20 eV, i.e. in the region of GZK-cut-off, . Today in high energy region we have only limited and contradictory information about the energy spectrum and chemical composition of the particles. ...
Asteroids, Comets, Meteors (2008) 8010.pdf SPECTRAL SIGNS OF CARBONACEOUS CHONDRITIC MATERIAL ON (21) LUTETIA V.V. Busarev, Sternberg Astronomical Institute (SAI), Moscow University, Universitetskij pr., ... We have discovered considerable variations in the continuum slope and shape of the visible-range reflectance spectra of the asteroid with rotation in November 2004 (4/5, 5/6 and 7/8) and March 2006 (3/4). ... Resulting normalized (at 0.55 m) and smoothed reflectance spectra are shown in Fig. ...
... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...
Елена Карагодина . ... Среди проблем новых религиозных течений (НРТ) можно отметить несколько таких, которые вызывают особенно острые противоречия, стимулируют развитие антикультового движения и попытки более жесткой законодательной регламентации. ... Очевидно, что нетолерантность к НРТ имеет несколько причин (социальные, культурные, политические, религиозные, психологические). ... Карагодина Е.Г., 1997, 1998 . ... Антикультовое движение в Украине: психологические и правовые основы . ...
ДД PROCEEDINGS OF THE 31st ICRC, LODZ 2009 1 Preliminary Proton and Helium Spectra from the CREAM-III Flight Y. S. Yoon , H. S. Ahn , T. Anderson, L. Barbier?, ... Keywords: CREAM; energy spectra; protons and helium nuclei I . ... CREAM-III I N S T RU M E N T A N D F LIGHT The CREAM-III instrument consisted of a tungsten/scintillating fiber calorimeter, a dual layer Silicon Charge Detector (SCD), a Cherenkov Camera (CherCam), a Cherenkov Detector, and a Timing Charge Detector (TCD). ...
... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...
... The Lectures Contents: Lecture one: Contemporary Historical and Political Background Part One: The Historical Stages of the Arab Political Development Part Two: The Nature of the Arab Political Systems and the Arab Modern Wars Lecture Two: The Middle East Scenario of Crisis and Conflict Part One: The Israeli/Palestine Crisis Part Two: The Superpowers' Role in the Arab Affairs Lecture Three: The Arab Modern Regional Politics Part One: The Arab Politics towards its Unitarian Movements. ...
OldFonts FONT PACKAGE The package gives a LaTeX user access to several traditional Russian font families used for book typesetting. ... Fonts contain modern Russian characters as well as those used in the 19th century Russian writing. The package also contains supplementary files that allow use of "Adobe Minion Pro" and "Palatino Linotype" font families with LaTeX. ... So all documentation is written in Russian. ... A.V.Dmitriev, 4 June, 2006. http://lizard.phys.msu.su, http://lizard.phys.msu.ru ...
... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...
... Submit your article . ... The article reveals peculiarities of the development of the high-tech sphere in the global economic environment. ... The role of venture ecosystem as a source of development of the high-tech sphere is examined in the article. The author identifies the problems of development of Russian venture ecosystem and demonstrates its prospects of an effective symbiosis of the state and the private initiatives against the background of favourable institutional conditions. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Electronic journal Issue 4. 10 september 2004 Briedis V. Pareto Structures A great Italian economist Vilfredo Pareto (1848 1923) in his unique economics and sociology studies [1, 2] continuously emphasised the systematic approach, reviewing the society development problems. ... Formal model of Pareto Structure First of all, provide a formal mathematical model adequately featuring the Pareto Structure. ... Indeed, I was primarily interested in the classical (harmonic structure) model at s = 1. ...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./briedis.pdf -- 388.0 Кб -- 06.07.2014 Похожие документы
... Магистерское образование . ... Enterprise Information Infrastructure . This course is focused on enterprise infrastructure and integration technology. Course presents different approaches to enterprise architecture and modern solutions of information infrastructure problems. Course?s topics cover strategies that help large enterprises to increase the agility of their IT systems. ... Enterprise portal technology, including collaboration and knowledge management . ... FI- Master data . ...
... CELL BIOPHYSICS Application of a Photosystem II Model for Analysis of Fluorescence Induction Curves in the 100 ns to 10 s Time Domain after Excitation with a Saturating Light Pulse N. E. Belyaevaa, V. Z. Pashchenkoa, G. Rengerb, G. Yu. ... In the case of weak measuring light, the steady-state level of fluorescence induction curve (Fig. ... The model of PSII predicted that, upon long (10 s) exposure to weak measuring light, the states with open RCs are being populated (Fig. 4, curves 3, 5 QA). ......
Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...
ISSN 1560-3547, Regular and Chaotic Dynamics, 2007, Vol. ... RESEARCH ARTICLES Interaction between Kirchhoff Vortices and Point Vortices in an Ideal Fluid A. V. Borisov* and I. S. Mamaev ** Institute of Computer Science, Udmurt State University, Universitetskaya ul. 1, 426034 Izhevsk, Russia Received March 1, 2005; accepted January 14, 2006 Abstract--We consider the interaction of two vortex patches (elliptic Kirchhoff vortices) which move in an unbounded volume of an ideal incompressible fluid. ...
[
Текст
]
Ссылки http://ics.org.ru/upload/iblock/099/147-interaction-between-kirchhoff-vortices-and-point-vortices-in-an-ideal-fluid_ru.pdf -- 359.3 Кб -- 28.10.2015 Похожие документы
... NUCLEI, PARTICLES, FIELDS, GRAVITATION, AND ASTROPHYSICS Wavelet Analysis of Fine-Scale Structures in the Saturnian B and C Rings Using Data from the Cassini Spacecraft E. B. Postnikova and A. Yu. ... These factors are especially important for the fine-scale structure of Saturn's A ring. ... The efficiency of the wavelet transform with a simple Morlet wavelet basis in solving this task was successfully demonstrated by our study of resonance structures in Saturn's A ring [10]. ...