... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>55) - electr003.chem.msu.ru/ )

• Pages of history: Eh-Film
• Galina A. Tsirlina: Eduard L. Nagaev. Scientific heritage

... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>2) - www.imec.msu.ru/ )

... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2396.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt

... Departments . ... sp@cmc.msu.ru . ... The Department prepares specialists in information technologies with a more profound knowledge in the following areas: the general questions of software engineering and information security, architecture of the system software including operating systems, compilers, database management systems, the telecommunication software and middleware. ... Algorithms and programming languages by Prof. Gayssaryan and Dr. Belevantsev, 54 lecture hours and 72 seminar hours. ...

Еще в разделе: (Показать все результаты (>120) - en.cs.msu.ru/ )

• Department of Computing Systems and Automation | CMC MSU
• Department of System Programming
• Department of Computing Systems and Automation

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... 2006 ARTICLE I. NAME AND PURPOSE Section 1. ... C. Secretary: The Secretary shall be the custodian of the records of the IHSS, maintain an up-to-date list of members in collaboration with the Vice President/President Elect and Chapter Coordinators, maintain minutes of all membership and Board meetings, conduct or supervise the correspondence of the IHSS, serve as editor of the IHSS Newsletter, and shall perform such other duties that may be delegated by the President, Vice President or the Board. ...

Еще в разделе: (Показать все результаты (>127) - mgumus.chem.msu.ru/ )

• Instructions for book-contributors
• MGUMUS -- Current projects
• Humates NATO ARW Home Page

Intel® Fortran Compiler Options Quick Reference Guide for Linux* Systems Legal Information Copyright © 2003 Intel Corporation Document Number: 253258-001 i Intel® Fortran Compiler Options Quick Reference Disclaimer and Legal Information Information in this document is provided in connection with Intel products. No license, express or implied, by estoppel or otherwise, to any intellectual property rights is granted by this document. EXCEPT AS PROVIDED IN INTEL'S TERMS AND CONDITIONS OF SALE FOR SUCH

Еще в разделе: (Показать все результаты (>16) - www.arcetri.astro.it/ )

• APOD: 2000 March 20 - Mercury on the Horizon

The Octotron Approach: Towards Autonomous and Reliable Operation of Supercomputers Alexander Antonov, Dmitry Nikitenko, Pavel Shvets, Sergey Sobolev, Konstantin Stefanov, Vadim Voevodin, Vladimir Voevodin, Sergey Zhumatiy Research Computing Center, Lomonosov Moscow State University, Moscow, Russia {asa,dan,shpavel,sergeys,cstef,vadim,voevodin,serg}@parallel.ru 1 Introduction ... 2 The Octotron System: Model-based Approach Octotron represents the supercomputer model in the form of a graph (Fig. ...

Еще в разделе: (Показать все результаты (>39) - hpc.msu.ru/ )

• MSU's HPC HISTORY | Moscow University Supercomputing Center
• Nationwide Supercomputing Education Project | Moscow University Supercomputing
• APPLICATIONS: Mechanics | Moscow University Supercomputing Center

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cmc.msu.ru ) . ... Alexander Valeryevich POZDNEEV (November 22, 1983, Novosibirsk, Russia) тАФ teaching assistant (assistant professor). Graduated with honours from the Faculty of Computational Mathematics and Cybernetics (CMC) at Lomonosov Moscow State University (MSU) (2006). Succesfully completed postgraduate study at the Faculty of CMC at Lomonosov MSU (2009). ... A.V. Pozdneev. ...

Еще в разделе: (Показать все результаты (>5) - ani.cmc.msu.ru/ )

• Alexander Valeryevich Pozdneev | Department of the Automation for Scientific

... Find the Brillouin zone for a 2D honeycomb lattice (lattice parameter d) and transform it into a hexagon. ... Compare the energies and the RMS charge radii electrons, in units of e). 1 2 (r )d3 x thus obtained ((x) is the total charge density of two 4. Find the density profile n(r) for an atom with the nucleus charge -Z e using the Thomas­ Fermi equation. ... Introducing the wavefunction (x) containing the low-energy degrees of freedom, find the effective wave equation for it. ...

Еще в разделе: (Показать все результаты (>4) - theorphys.phys.msu.ru/ )

... Statutes of ERC . Methodical Commissions of ERC . ... The Methodical Commissions of the MSU Nanotechnology Education and Research Center (ERC) are set up according to all the research specializations of ERC. The Methodical Commissions of ERC are collegial bodies that prepare education programs of ERC and programs for developing courseware and training materials. ... ERC participants may be mutually agreed with members of methodical commissions representing relevant faculties and chairs. ...

Еще в разделе: (Показать все результаты (>11) - nano.msu.ru/ )

... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...

Еще в разделе: (Показать все результаты (>3) - www.bio.msu.ru/ )

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... BDRG . ... DEPRON . ELFIN-L . ... The satellite ?Mikhailo Lomonosov? is based on the platform of the spacecraft ?Kanopus-B? developed by the All-Russia reasearch and development institute of electromechanics named after Iosiphyan (VNIIEM). ... Scientific equipment will weight about 120 kg, while the total weight of the satellite will be about 450 kg. ...

Еще в разделе: (Показать все результаты (>30) - lomonosov.sinp.msu.ru/ )

• News | Университетский спутник "Ломоносов"

. Home . Structure of Data . Description . Catalog . Publications . VO . ЮБ 2000 . 11:14:20.2 . ЮД 2000 . -57:33:04 . l . 290.172 . b . 2.895 . diameter . 14.0' . (m - M) 0 . 11.4 0.05 . distance . 1900 50 pc . E(B - V) . 0.08 0.01 . log(t) . 9.65 0.05 . (J, J-H) isochrone VOTable . 2MASS data VOTable . Developed by the Team . Send us your questions or feedback

Еще в разделе: (Показать все результаты (>209) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Berkeley 53
• SAI OCL Catalog Berkeley 71
• SAI OCL Catalog Berkeley 72

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>43) - scon155.phys.msu.su/ )

... О межфакультетских курсах МГУ . Видео МФК . ... Канал МГУ на YouTube . ... Комментарии Дата Просмотры Лайки Комментарии Упорядочить по возрастанию . ... x25BA; Кинофонд МГУ (95) . ... x25BA; Фильмы о МГУ (5) . ... x25BA; СУНЦ МГУ (5) . ... x25BA; МФК (1084) . ... x25BA; Механико-математический факультет (5) . ... x25BA; Социологический факультет (13) . ... x25BA; Факультет журналистики (11) . ... x25BA; Факультет наук о материалах (7) . ... Copyright 2016 ї Видеоархив МГУ имени М.В.Ломоносова . ...

Еще в разделе: (Показать все результаты (>176) - media.msu.ru/ )

• Университетские субботы (МГУ-школе) | Видеоархив МГУ имени М.В.Ломоносова

... Начало www.99ru.ru Религия и эзотерика Христианство 1314 . ... История.Философия . ... Застольные беседы (речи) Мартина Лютера 1566г репринт оригинала Luthers Tischreden Немецкий Готический шрифт . ... Martin Luther died on the 18th of February, 1546, and the first publication of his "Table Talk"-Tischreden-by his friend, Johann Goldschmid (Aurifaber), was in 1566, in a substantial folio. ... He began his studies at the University of Wittenberg in 1537, where he attached himself closely to Luther. ...

Еще в разделе: (Показать все результаты (>18) - www.bukivedi.ru/ )

• www.99ru.ru - 1984 6242

... Anatoliy A. Polikarpov . Among various kinds of typological development in language system there are two significant interrelated cases, namely, cases of language system drift to more analytic or, on the countrary, to more synthetic structure. ... These two factors contradict each other in the process of building a new system on the stage of speech adaptation, but they coincide in the "direction" of their action on the stage of language adaptation. ... BREITER M.A., POLIKARPOV A.A. [1997]. ...

Еще в разделе: (Показать все результаты (>53) - old.philol.msu.ru/ )

• Footnotes
• MSU-LGCLL:: O.V. Kukushkina, A.A. Polikarpov, D.V. Khmelev - Authorship
• HumLang - How to subscribe our list

... 17, No. 10 (2007) 3603­3606 c World Scientific Publishing Company STABILIZATION OF CHAOTIC BEHAVIOR IN THE RESTRICTED THREE-BODY PROBLEM ARSEN DZHANOEV and ALEXANDER LOSKUTOV Physics Department, Moscow State University, Leninskie Gory, Moscow 119992, Russia janoev@pol ly.phys.msu.ru Loskutov@chaos.phys.msu.ru Received Octob er 19, 2005; Revised February 20, 2006 The restricted three-bo dy problem on the example of a perturbed Sitnikov case is considered. ... The Sitnikov problem. ... Fig. ...

Еще в разделе: (Показать все результаты (>59) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/JCTE1358.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/PHDK634.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/Astron_lett1.pdf

... International Studies . ... Admission for International Students . ... For Students . ... General Russian Courses . ... The Faculty of Foreign Languages and Area Studies at Moscow State University offers courses of General Russian to learners of all levels from Absolute Beginners through to Advanced. ... Beginners I - This course aims to help the student to acquire some knowledge of basic Russian, so that s/he can communicate with Russians, using basic vocabulary and grammar to express him/herself. ...

Еще в разделе: (Показать все результаты (>63) - ffl.msu.ru/ )

• Иностранным гражданам
• About Us