Mathematical modeling of biophysical processes in living cells and tissues . duration 6 months . ... 7(095) 939-26-12, Fax: +7(095)939-31-13, Email: romanov@yumr.phys.msu.ru . ... Interaction of femtosecond laser pulses with plasmas of modified targets . ... Theoretical investigations of polarization self-action and wave-interaction effects in nonlinear optics. ... Alexander V. Priezzhev, Associate Professor, Candidate of Sciences (physics and mathematics), Tel. ...

Еще в разделе: (Показать все результаты (>22) - foroff.phys.msu.ru/ )

• Postdoctoral training of foreign scientists at Physical Department

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Magnetospheric particles and radiation conditions . ... Scientific equipment . ... Scientific payload of the ?Lomonosov? satellite will include a complex of the devices ELFIN-L and DEPRON for the studies of the processes of the charged particles penetration into the upper atmosphere of the Earth and for the analysis of the radiaiton conditions at low altitudes. ...

Еще в разделе: (Показать все результаты (>59) - lomonosov.sinp.msu.ru/ )

• Scientific goals | Университетский спутник "Ломоносов"
• DEPRON | Университетский спутник "Ломоносов"
• Gamma-bursts | Университетский спутник "Ломоносов"

... THE EFFECT OF CATALYST ON COMPOSITION OF ETHYLENE/1-HEXENE COPOLYMERS DETERMINED BY MODIFIED FTIR METHOD . ... Copolymerization of ethylene with 1-olefins is very important process using mainly to change properties of polyethylene. ... This effect is dependent on polymerization conditions, comonomer type and above all catalytic system [1]. ... The composition of ethylene/1-olefin copolymers is usually determined by IR or 13 C-NMR methods. ...

Еще в разделе: (Показать все результаты (>140) - www.chem.msu.ru/ )

... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...

Еще в разделе: (Показать все результаты (>11) - imk.msu.ru/ )

About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...

Еще в разделе: (Показать все результаты (>3) - textbook.sinp.msu.ru/ )

Normal and system lupus erythematosus red blood cell interactions studied by double trap optical tweezers: direct measurements of aggregation forces Maria D. Khokhlova Eugeny V. Lyubin Alexander G. Zhdanov Sophia Yu. ... Direct measurements of aggregation forces in piconewton range between two red blood cells in pair rouleau are performed under physiological conditions using double trap optical tweezers. ... One of the SLE clinical signs is a considerable enhancement of RBCs aggregation forces. ...

Еще в разделе: (Показать все результаты (>46) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/jbo17_101510_2012.pdf

... Dear Edoardo Costantini, Alex Makeev, John Catt, Leon Follmer, Arnt Bronger . ... INQUA and IUSS. ... previous Paleopedology Commission, that has duly elected its new Chair and . ... the IUSS the now Provisional Commission on Paleopedology (until now Working . Group) within Division 1 (like the new Pedometrics) will presumably receive . final approval during the 2004 IUSS Council meeting. ... Edoardo and Alexander. ... would have been a joint meeting with the Paleopedology group, did I wrong?) ...

Еще в разделе: (Показать все результаты (>145) - www.fadr.msu.ru/ )

• Foundation for Agrarian Development Research - Projects
• Abstracts
• NAP - subject matter topics

... 2013/04/16 - 11:59am . Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Site map . Site search . MSU website . ... This site (RSS) . E -mail: info@hsmi.msu.ru . Phone: +7 495 932-80-73 . Fax: +7 495 932-80-73 . 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>7) - hsmi.msu.ru/ )

... Funds/Grants Page at Moscow State University [In Russian] . ... Physics Journals . ... Information for authors . ... Laser Physics (MAIK NAUKA) . ... Quantum Electronics . ... Quantum Optics, Quantum Information, and Quantum Computing . ... European Research Network--The Physics of Quantum Information . ... Quantum Information Processing National Project (Germany) . Quantum Imaging Lab, Boston University . ... Institute for Quantum Information (Caltech) . ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>75) - qilab.phys.msu.ru/ )

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>135) - bioinf.fbb.msu.ru/ )

• SDPpred
• SDPlight
• SDPsite - Algorithm Format requirements

... Khimiya) .. ,~c~"C' Vol. ... Khimiya UDC 579.088;577.158.54 DEVELOPMENT OF A PHENOMENOLOGICAL MODEL OF THE KINETICS OF BACTERIAL ADSORPTION ON LOW-ENERGY SURFACES V. V. Fedorovich, S. V. Kalyuzhnyi, P. van der Meeren., and W. Verstraete.. ... Our work was dedicated to the establishment of a quantitative relation between the rate of adsorption of a certain class of microorganisms on polymeric materials and their adhesion to the latter. ... In this case the rate of adsorption does not depend on 6.Gh. ...

Еще в разделе: (Показать все результаты (>127) - www.enzyme.chem.msu.ru/ )

• http://www.enzyme.chem.msu.ru/ryabov/pdf/JPOC_99.pdf
• products
• index

. Links . arXiv.org (Lanl gov) . Large amount of articles . http://arXiv.org . Scientific Electronic Library . http://www.elibrary.ru . Elsevier Science; Kluwer Academic Publishers; Springer Berlin Heidelberg . and others... Laboratory of Theoretical Nonlinear Dynamics in Institute of Radio-Engineering and Electronics of RAS, Saratov Branch IRE RAS . http://www.sgtnd.tserv.ru . Head of the group Doctor of Sciences, Professor Sergey P. Kuznetsov . Painter Andrey Isaev . http://www.IsaevArt.ru .

Еще в разделе: (Показать все результаты (>65) - chaos.phys.msu.ru/ )

... COLAMO [1] . Fire!Constructor [2], . ... Fire!Constructor ( Include COLAMO). ... 4 - Fire!Constructor COLAMO - ARGUS. ... ARGUS : Define N = 5; Define K = 6; Define M = 1; DMC[0.A] # Metka : Read A step M repeat K; Add A, K; Loop N Goto Metka; DMC[0.C] # Metka1 : Read C step M repeat K; Add C, K; Loop N Goto Metka1; DMC[0.D] # Metka2 : Read D step M repeat K; Add D, K; Loop N Goto Metka2; DMC[0.B] # Metka3 : Write B step M repeat K; Add B, K; Loop N Goto Metka3; Read ­ , (.. ...

Еще в разделе: (Показать все результаты (>3) - fpga.parallel.ru/ )

• Терминология

... CUBLAS и CUFFT - прикладные библиотеки, использующие CUDA для умножения матриц и преобразования Фурье. CUDA Data-Parallel Primitives Library - библиотека некоторых распространенных операций с данными, реализованных при помощи CUDA. ... ACML-GPU - процедуры математической библиотеки AMD ACML, реализованные на графическом процессоре. ...

Еще в разделе: (Показать все результаты (>3) - gpu.parallel.ru/ )

... OK ======================================= To compile CompHEP input make command ======================================= make # command output : ****************************************************************** * CompHEP -4.4p3 has been successfully built * * * * Please create a user working directory using the command * * make setup WDIR=path_to_your_user_work_dir * * NOTE: Do not use '~' to refer to home ... CompHEP-interfaces-1.0.1 has been installed successfully!! ...

Еще в разделе: (Показать все результаты (>5) - lhe.sinp.msu.ru/ )

... Клуб выпускников / Доска объявлений . клуб выпускников члены клуба вступить в клуб наши партнеры . Поиск работы и вакансии . ... Для участия в разработке информационных систем для гражданской авиации (Linux, C++, Oracle) с возможностью проявить себя требуются программисты C++. ... приветствуется знакомство с Unix/Linux, SQL, любой уровень знания английского . ... премии по результатам работы . место работы - рядом с м. Динамо . ... URL: http://http://www.sirena2000.ru/sirena/about.html . ...

138. http://science.chem.msu.ru/index.php?view=article&catid=34%3Anews&id=144%3A2013-10-24-11-52-14&format=pdf&option=com_content&Itemid=57

139. Page4

140. NEW MSU Graduates Club notice board