... Conferences . M.V.Lomonosov Moscow State University . Faculty of Mechanics and Mathematics . ... Moscow State University . 119991 Moscow RUSSIA . ... Contact: room A1620, Moscow State University main building . ... Our " Conferences " section has been updated . ...

Еще в разделе: (Показать все результаты (>34) - higeom.math.msu.su/ )

BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...

Еще в разделе: (Показать все результаты (>2) - muscle.imec.msu.ru/ )

Компьютерные методы в физике . ... На семинарских занятиях в начале семестра изучаются редакторы WinWord и TeX , графический редактор Origin . Во второй половине семестра семинарские занятия посвящены программированию для Windows в среде Visual С. На практических занятиях студенты выполняют зачетную работу в редакторах WinWord и TeX , упражнение с использованием графического редактора, упражнения и зачетное задание по программированию для Windows . ... WinWord . ... Стандартное окно редактора. ...

Еще в разделе: (Показать все результаты (>21) - ofvp.phys.msu.ru/ )

Alignmentfree telomere length estimation from whole genome NGS data Szymon M. Kielbasa1Jelle Goeman2Hein Putter1 NL Consortium orret Boomsma3 , , Go , , D , Eline Slagboom1Kai Ye4 , 1 Department of Medical Statistics and Bioinformatics, Leiden University Medical Center, Leiden, Department for Health Evidence, Radboud university medical center, Nijmegen, The Netherlands Netherlands Twin Register, Department of Biological Psychology, VU ...

Еще в разделе: (Показать все результаты (>98) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/199.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/31.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/156.pdf

MASS Software Version 2.04 User Guide V.Kornilov, N.Shatsky, O. Voziakova Decemb er 30, 2003 Contents 1 MASS software op eration overview 1.1 Main features of measurement pro cess with MASS instrument . ... 2 Installation, tuning and startup 2.1 Installation of the MASS software Turbina 2.2 Editing the configuration file . ... 4.2 Output data in MASS Software . ... 4.2 Output data in MASS Software The output of Turbina program op erating the MASS device is directed to an ASCI I file called mass-file. ...

Еще в разделе: (Показать все результаты (>23) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/massug_eso.pdf
• http://curl.sai.msu.ru/mass/download/doc/pmt_param_eng.pdf

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Компания 'Библиотечная компьютерная сеть' разрабатывает и внедряет Автоматизированные библиотечные информационные системы ( АБИС ): каталогизатор книг - создание электронного каталога библиотеки , учет книг . Автоматизированные библиотечные информационные системы (АБИС) компании 'БКС' предоставляют современные возможности по работе с электронными каталогами и читателями . 123181, Москва, Ул. Исаковского, д.12, кор.1, Библиотека, ООО "БКС". bks-mgu@yandex.ru . ...

Еще в разделе: (Показать все результаты (>43) - www.bks-mgu.ru/ )

• Библиотечная Компьютерная Сеть | Продукты Библиотечная компьютерная сеть |
• Библиотечная Компьютерная Сеть | FAQ | Программное обеспечение для библиотек |
• Установка

... A B? · : ­ ­ Sender Window Size ­ ­ Last ACK Received ­ ­ Last Segment Sent ­ ­ · : ­ ­ ­ ­ ­ Receiver Window Size ­ Largest Acceptable Segment ­ Last Segment Received - SW #1 1 Sender : SWS = 3 LAR = 0 LSS = 1 Receiver : RWS = 1 LAS = 1 LSR = 0 SW #1 1 2 Sender : SWS = 3 LAR = 0 LSS = 2 Receiver : RWS = 1 LAS = 1 LSR = 0 SW #1 1 2 3 Sender : SWS = 3 LAR = 0 ... SW #3 · p = 16 * 8 = 128 . ... 50 128 = = 64 / -3 100 10 SW #4 · A 32 B SW. RTT = 80 , 128 /. ...

Еще в разделе: (Показать все результаты (>9) - lvk.cs.msu.su/ )

Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...

Еще в разделе: (Показать все результаты (>2) - swx.sinp.msu.ru/ )

Supernova 2002dv and 2002eg in UGC 11486 . This page is devoted to information on Supernova 2002dv and Supernova 2002eg in UGC 11486 Basic information on this SN, including the last reported brightness, on this Supernova can be found on the main page . ... Ella Sanders discovered this one, the thrid double SN in four months, almost a stastical impossibility. ... SNWeb has a 2002dv page . ... Ella Sanders 2002eg images page 1 and 2002eg images page 2 . ... 2002/07/01.4 . ... Ella Sanders image . ...

Еще в разделе: (Показать все результаты (>424) - www.rochesterastronomy.org/ )

• Supernova 2009js in NGC 918
• Supernova 2002fk in NGC 1309
• Supernova 1999gi in NGC 3184

... if (B1) { S1; } if (B1) { S1; } if (B2) { S2; } - - ...exp... int x = 1; if (x == 1) { std::cout << "Okay" << std::endl; } else { std::cout << "Error" << std::endl; } -- ­ int strlen(const char* p) { int len = 0; do { ++len; } while (*p++); return len; } «», «bbb» -- , : · ­ , , · ­ , , · ­ , · ­ . ... 1977 ­ LTL, · , 1981 ­ (CTL), · , , 1981 , , 1982 ­ model checking ( ), · , 1986 ­ model checking ( ), · , 1989 ­ SPIN. ... The Spin Model Checker: Primer and Reference Manual, Addison Wesley, 2003. ...

Еще в разделе: (Показать все результаты (>3) - savenkov.lvk.cs.msu.su/ )

P-X», «PL-X» ("") 2008 www.elins.su , . ... 0,009% 100. 0,1% . ... Counter" () ( , ). ... PS-Pack . ... USB USB-RS232, . ... 0.65 / 8 2,3 / 30 1,1 / 30 10 / 150 (1 .) ... 0.65 / 10 2,5 / 37 1,2 / 45 27 / 400 * (0,3 .) 0.65 / 10 2,5 / 37 1,2 / 45 27 / 400 11 / 160 27 / 400 P-8 (S) P-30 (S) P-30M (SM) P-150 (S) PL-50 PL-150 (S) 5. Ps_Pack_s , ( Ps_Pack_s 17,03,2008). ... P-05 P-8 P-8S P-30 P-30S P-30I P-30M P-30SM P-30IM P-150 P-150S P-150I P-150IL PL-50 PL-150 I USB- PS_Pack_s. 6. ...

Еще в разделе: (Показать все результаты (>39) - electr003.chem.msu.ru/ )

Документация по Дейталог-системе, . ... Program> :: = <Statement List> . ... Rule> :: = <Predicate> :- <Predicate List> . Predicate> :: = constant ( <Term List> ) . ... Дейталог-система тестировалась с СУБД SQLite [ http :// www . sqlite . ... Для сборки Дейталог-системы вам потребуется компилятор Bigloo [ http :// www - sop . ... Если вы работает с Unix -подобной ОС, переименуйте файл Makefile . ... h файлов и библиотек Bigloo - BIGLOO _ INC _ DIR , BIGLOO_LIB_DIR . ... edb "anc/1.sqlite" . ...

Еще в разделе: (Показать все результаты (>136) - sp.cs.msu.ru/ )

• Execution performance of NAS tests
• Lib-DVM. Detailed design
• Debugging DVM-program performance. User's guide

script language= javascript on=mw=null; fl=ofl=0; mc=me=0; t=0; b=0; ch=bt=bn=0; wn=wt=null; sl=0; t2=0; function Is0CC28989() { this.n=(document.layers)?true:false; this.o=(navigator.userAgent.indexOf('Opera')!=-1)?true:false; this.i=(document.all (!this.o))?true:false; this.d=(document.getElementById)?true:false; } var is0CC28989=new Is0CC28989(); function Stor() { if(is0CC28989.n (top.frames.length 0)){ return top.frames[0]; } ...

Еще в разделе: (Показать все результаты (>168) - www.kosmofizika.ru/ )

• Magnetometers Database

... 15 2.1 Stuxnet .. ... 25 2.2 Wiper .. ... IT- ( , ) , Stuxnet, Flame, Gauss, Duqu, Wiper Icefog. ... Microsoft Windows (DLL) . ... 17 ; -- Microsoft, ­ , ­ ; , ; Windows rootkit, ; ; «» Siemens, ; , , , rootkit . ... MS08-067 ( 2009 Kido, 20 ) MS10-061 (zero-day ); (zero-day ) MS10-073 (Windows 2000 XP) MS10-092 (Windows Vista, x64), , ; Stuxnet peer-to-peer (P2P) ; , , ; e SIMATIC, Siemens, , , . ... 38 - : http://www.securelist.com/ru/blog/207764003/Flame_Bunny_Frog_Munch_i_BeetleJuic e ­ Hiew. ...

Еще в разделе: (Показать все результаты (>15) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/publications/Project_2015.pdf

... Полная версия: Не могу найти тему с картинкофлудом . Грация-МГУ::Форум > Общение > Общение . ... Feb 1 2008, 12:45 . ... Mar 5 2008, 12:30 . ... http://news.online.ua/2008/03/05/1056578914.php . ... Нажмите для просмотра прикрепленного файла . ... Apr 2 2008, 23:00 . ... Jun 15 2008, 09:34 . ... А если найду?" (с) . ... Jul 18 2008, 23:15 . ... Sep 8 2008, 12:17 . ... Цитата(Reaper @ Sep 12 2008, 23:31) . ... Для просмотра полной версии этой страницы, пожалуйста, нажмите сюда . ...

Еще в разделе: (Показать все результаты (>42) - grace.msu.ru/ )

• Грация-МГУ::Форум > Учимся водить машину
• Учимся водить машину - Грация-МГУ::Форум
• Не могу найти тему с картинкофлудом - Грация-МГУ::Форум

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... This section presents the results of the application of the methodology described in the previous section to real EEG signal. ... Fig. 7.1. Detection algorithm adapted for the EEG analysis . The EEG (a) was filtered in the alpha band (bandpass 7.5--12.5 Hz) (b) and then the amplitude squared (c); the result is the sequence from which the subintervals are cut out at further steps. ...

Еще в разделе: (Показать все результаты (>37) - brain.bio.msu.ru/ )

• Analysis of change-point synchronization in multi-channel EEG
• Nonparametric approaches to the description of EEG piecewise stationary
• Spatial synchronization of the change-points

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...

Еще в разделе: (Показать все результаты (>2) - ocl.sai.msu.ru/ )

компьютерные курсы . курсы . ... Базовые курсы . курс по Microsoft Word . курс по Microsoft Excel . курс по Microsoft Access . ... курс "Программирование на C# с использованием Microsoft.Net" . курс "Администрирование Microsoft Windows Server 2003" . курс "Настройка безопасности в сетях Microsoft Windows Server 2003" . курс "Программирование в Microsoft SQL Server 2000-2005" . Все курсы ведут преподаватели механико-математического факультета МГУ . ... Microsoft . ...

140. MonKar4