XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>6) - scon155.phys.msu.ru/ )

ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Well-known multinational company (technical, broadcast and computer equipment) is looking for Assistant in service sales support department. ... processing of sales correction requests, frontline contacts on service sales related issues . service sales administration support, operational performance monitoring . ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>46) - www.cmc-online.ru/ )

• ВМиК - Online! : Работа для выпускников и студентов ВМК МГУ - Вакансии Intel
• ВМиК - Online! : Интересно - Лекция Microsoft: Future Directions in Computer
• ВМиК - Online! : Новости - Компания LSI Logic объявила конкурс на получение

.

Еще в разделе: (Показать все результаты (>617) - xray.sai.msu.ru/ )

• Cosmion-2001
• Vyacheslav Ignatiev Homepage
• Cosmion-99

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>95) - electr003.chem.msu.ru/ )

• Evgeny V. Antipov:CV
• Alexander Mikhailovitch Kuznetsov (Sasha)

Sergey Vladimirovich Petrushanko Afflilation and official address: Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow State University Leninskiye Gory, Moscow 119991, Russia E-mail: sergeant@mail.cern.ch Date and place of Birth: 24 March 1975, Sverdlovsk (USSR) Citizenship: Russian Federation Education: 2002 Ph.D. (High energy physics ) Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow ...

Еще в разделе: (Показать все результаты (>227) - lav01.sinp.msu.ru/ )

• Activity of Igor Lokhtin
• Sergey Petrushanko Participation in Schools and Conferences
• Seminar of Strong Interaction Laboratory

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>5) - www.eng.geogr.msu.ru/ )

• Administration
• Selenga-Baikal research

... Посетите Неофициальный сайт Геофака МГУ . Наука >> Геология >> Инженерная геология, мерзлотоведение и грунтоведение | ... Написать комментарий . ... III International conference on cryogenic soils . ... III International conference on cryogenic soils будет проходить 27-31 августа 2001 года в Копенгагене, Дания. Обращаться: Dr. Bjarne Holm Jakobsen, Institute of Geography, University of Copenhagen, Oster Voldgade 10, 1350 Copenhagen K Denmark. Tel: 45 3532 2500; Fax: 45 3532 2501 . ...

Еще в разделе: (Показать все результаты (>924) - www.nature.web.ru/ )

• First International Conference on Sustainable Development in Karst Regions
• Theoretical Computer Science: взгляд математика

... He was graduated from Moscow State University, Faculty of Mechanics and Mathematics, and post-graduate course in a speciality Theory of Probabilities and Mathematical Statistics. ... Ph.D in mathematics in 1980 (Moscow State University, Faculty of Computer Science). ... Author of Popular Textbooks on Data Analysis and Statistics. ... He was graduated from Moscow State University in 1980. Ph.D in mathematics in 1988 (Moscow State University, Faculty of Mechanics and Mathematics). ... InCo . ...

Еще в разделе: (Показать все результаты (>6) - statsoft.msu.ru/ )

• InCO General Information In English

Алексеевский Андрей Владимирович . ... Миронов Андрей Александрович . ... Тем не менее, посещение страницы "Тьюторы ФББ" может быть полезным для выбора тьютора . ... Для студентов 1-го курса: Можно начать поиски тьютора уже сейчас! ... Активность в выборе темы и руководителя - за студентом. Студент выбирает руководителя и тему, просит руководителя взять его на данную тему. ... Студент сообщает о договоренности (фамилии студента и тьютора, название темы) Л.А.Зиновкиной . ...

Еще в разделе: (Показать все результаты (>1493) - kodomo.cmm.msu.ru/ )

• Department of animal cell biochemistry - Staff and contacts
• Department of animal cell biochemistry - Conferences
• EC/KEGG

О кафедре . ... Наглядная и компью терная геометрия и топология . ... Г.В.Носовский. ... Математические заметки, т. 33, вып. 2, 1985, с. 325-333. ... Об условиях, возникающих при оценке производных решений стохастических дифференциальных уравнений в римановых пространствах.. ... Тезисы Бакинской международной конференции по топологии и ее приложениям. ... В.В.Калашников, Г.В.Носовский, А.Т.Фоменко. ... Г.В.Носовский, А.Т.Фоменко. ... Вып. ... А.А.Голованов, Д.П.Ильютко, Г.В.Носовский, А.Т.Фоменко. ...

Еще в разделе: (Показать все результаты (>56) - dfgm.math.msu.su/ )

• 2nd Announcement
• 1st Announcement
• Conference dedicated to the memory of Professor Yu. P. Solovjev

... Angewandte Chemie International . Chemical Physics Express . ... HYLE - An International Journal for the Philosophy of Chemistry . ... Journal of Molecular Modeling . ... Journal of Vacuum Science & Technology . Polarization Spectroscopy of ordered systems (PSOS Newsletters). PBMRT - Bio/Chemical Journals and Newsletters . Protein Science . Chemical Physics Preprint Database . The Journal of Physical Chemistry . ... Journal of Chemical Information and Computer Science . ...

Еще в разделе: (Показать все результаты (>46) - www.kge.msu.ru/ )

• Научная информация
• Scientific journals
• Ozone Workshop

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Outreach . ... TEPA?2012 was held at Lomonosov Moscow State University, Russia. ... Workshop on ?Lomonosov? project held in Moscow State University, November, 28-30, 2011 . ... Current state of the project as a whole. ... Space vehicle status. ... Universitetsly-Tatiana-2?, and the space project ?Chibis?, being developed by Space Research Institute of RAS (IKI RAS) in collaboration with Moscow State University. ...

Еще в разделе: (Показать все результаты (>16) - lomonosov.sinp.msu.ru/ )

Curriculum Vitae of Dr Alexei A. Mailybaev . ... A.P. Seyranian and A.A. Mailybaev, Multiparameter Stability Theory with Mechanical Applications , World Scientific, New Jersey, 2004. ... A.A. Mailybaev and A.P. Seyranian, Bifurcations of equilibria in potential systems at bimodal critical points, Journal of Applied Mechanics 75 (2008), 021016. ... A.P. Seyranian and A.A. Mailybaev, On stability boundaries of conservative systems, Journal of Applied Mathematics and Physics (ZAMP) 52 (2001), 669-679. ...

Еще в разделе: (Показать все результаты (>29) - mailybaev.imec.msu.ru/ )

• Dr Alexei A. Mailybaev

... Optical Tamm state at the cholesteric liquid crystal/metal interface Gulkin D.N., Bessonov V.O., Sob oleva I.V., Fedyanin A.A. Faculty of Physics, Lomonosov Moscow State University, Moscow, 119991, Russia e-mail: bessonov@nanolab.phys.msu.ru Optical Tamm state (OTS) is an optical analogue of Tamm state which is electronic density lo calization at the b oundary of p erio dic atomic p otential. ... Fig. 1c demonstrates that the OTS excitation o ccurs over a large range of angles of incidence. ...

Еще в разделе: (Показать все результаты (>75) - nanolab.phys.msu.ru/ )

• Tatyana V. Dolgova | Laboratory of Nanophotonics & Metamaterials
• Ultrafast plasmonics and magnetoplasmonics | Laboratory of Nanophotonics &

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>26) - dbserv.sinp.msu.ru/ )

• Links

... Русский English . Background . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Each of FBB students is to successfully complete and defend three yearly research projects, in bioinformatics, biochemistry, and bioengineering. ...

Еще в разделе: (Показать все результаты (>3) - en.fbb.msu.ru/ )

• BackgroundтАФ Faculty of Bioengineering and Bioinformatics, MSU

... Since 1993 lecturers of the MSU Faculty of Physics have been reading a course on ?Programming and Information Technology?. ... In 2008 the Dean of the Faculty of Physics approved a new curriculum, which allowed advanced second-year students to take a course in one of the following disciplines instead of the basic programming course: Microcontroller Programming , FPGA Design , Parallel Programming , and Computer-Aided Science Engineering (CASE) . ...

Еще в разделе: (Показать все результаты (>90) - engineering.phys.msu.ru/ )

• Participation in INNOPROM-2015
• Parallel Programming

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Gas Sensors Laboratory (SENSOR) , Department of Chemistry and Physics for Engineering and for Materials , University of Brescia , Italy: Prof. Giorgio Sberveglieri, Guido Faglia, Maurizio Artoni, Camilla Baratto, Dario Zappa. Lab contact Prof. Alexander Gaskov. ... Laboratory contact person: Dr. S.G. Dorofeev . ... 2008-2010 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>52) - www.lssm.inorg.chem.msu.ru/ )

... Ph.D., assistant professor, School of Public Administration, Lomonosov Moscow State University. ... The author reviews the published proceedings of the Internet-conference organized in April, 2012 by the Human Resources Management Department, School of Public Administration, Lomonosov Moscow State University. ... Conference, management of human resources, efficiency of HRM programs in Russia. ... Public Administrarion". 119991, Room A-710, Shuvalovskiy building, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>267) - ee-journal.spa.msu.ru/ )