МГУ имени М.В.Ломоносова Русская версия . ... Section ?Psychology? ... 29 Feb 2016 . ... 15 Apr 2016 . ... Chair Yury P. Zinchenko, professor, Dean of the Faculty of Psychology MSU . ... Chair Yury P. Zinchenko, Dean of the Faculty of Psychology MSU, academician RAE . ... A.G.Asmolov chair of the department of Personal Psychology, academician RAE; . ... B.S.Bratus chair of the department of General Psychology, corresponding member RAE; . ... Actual problems of sport psychology and healthy lifestyle. ...
... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...
... This is so elementary it hardly needs comment . ... Единица (меньше единицы по модулю) . ... Group unit element . ... Единичная геометрическая краткость . ... Unit normal . ... Let $v$ be a vector of unit length . Единичный вектор внешней нормали . Unit outer normal vector . Outer normal unit vector . Единичный вектор восходящей нормали . ... Единичный вектор касательной . ... Единичный вектор направления движения . ... Normal unit vector . Unit normal vector . ... One component . ...
Site navigation: . ... Publications . ... SPDC Laboratory . Quantum Electronics Chair . ... Site configuration . Error: You currently have Javascript disabled. ... The problem of preparing entangled pairs of polarization qubits in the frequency-nondegenerate regime?, ... Download [ help ]: . Download paper: doi page . Download paper: Full text . ... All persons copying this information are expected to adhere to the terms and constraints invoked by each author's copyright. ...
XXVIII General Assembly of the IAU, SPS15 Beijing, August 31, 2012 . N.N. Samus, S.V. Antipin "Variable Stars and Data-Intensive Astronomy" . During the 26th IAU General Assembly in Prague, the IAU Division V (Commissions 27 and 42) considered the future of variable-star catalogues. ... To discuss these problems and to look for their solutions, the IAU Commission 27, on behalf of the IAU Division V, created an informal working group, chaired by the GCVS editor, Dr. Nikolai Samus. ...
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
Transhumus : Integrated software solution for interpretation of FT-ICR mass spectra of natural organic matter Anton Grigoryev1, 2, Alexey Kononikhin 1 2 2, 3 , Irina Perminova4, Eugene Nikolaev2, 3 ansgri@gmail.com Institute for Energy Problems of Chemical Physics, Moscow , Russia 3 Institute of Biochemical Physics, Moscow , Russia 4 Lomonosov Moscow State University, Moscow , Russia Natural organic matter ( ... However, there still are problems with interpretation of mass spectra of NOM. ...
[
Текст
]
Ссылки http://www.mgumus.chem.msu.ru/publication/2010/2010-grigoryev-transhumus.pdf -- 315.1 Кб -- 26.11.2010
[
Текст
]
Ссылки http://mgumus.chem.msu.ru/publication/2010/2010-grigoryev-transhumus.pdf -- 315.1 Кб -- 26.11.2010 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Ground Ice from Larsemann Hills Oasis (East Antarctica): Geological Occurrence, Properties and Genesis Belova N.1, Verkulich S.R.2, Demidov ... ,3 Lomonosov Moscow State University, Faculty of Geography, Moscow, Russia nataliya-belova@ya.ru 2 Arctic and Antarctic Research Institute , Saint-Petersburg, Russia 3 Institute of Physicochemical and Biological Problems in Soil Science, Russian Academy of Sciences 4 Vernadsky ... Two different types of ground ice were observed in these deposits. ...
[
Текст
]
Ссылки http://www.geogr.msu.ru/structure/labs/geos/personal/belova/Belova_2013_Pushchino.pdf -- 106.7 Кб -- 11.10.2013 Похожие документы
... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...
... 12, 43 44 (2012) / DOI 10.1002/pamm.201210013 Cases of Complete Integrability in Transcendental Functions in Dynamics and Certain Invariant Indices Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., 1, 119899 Moscow, Russian Federation The results of this work appeared in the process of studying a certain problem on the rigid body motion in a medium with resistance, where we needed to deal with first integrals having nonstandard properties. ...
... We live in the epoch of modern informational, scientific and intellectual technologies. Modern person, especially young one, cannot imagine life without computers, cellular phones and high-speed Internet. ... History has given a lesson - having splendid science, excellent education and highly organized society, having colossal resources, being a great power, we could not cope with the task - to build a prospering and just society. ... It demonstrates the colossal possibilities of modern science. ...
Summary Progress Report 2010 2014 UNESCO Chair on Global Problems and Emerging Social and Ethical Challenges for Large Cities and Their Population at the Faculty of Global Processes of the Lomonosov Moscow State University Period of activity: September 2010 June 2014 Title of the Chair : UNESCO Chair on Global Problems and Emerging Social and Ethical ... Visit of UNESCO Director-General Irina Bokova at Moscow State University September 9, 2011. ...
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf -- 1926.1 Кб -- 13.09.2014 Похожие документы
... О UNИX . ... ApacheWithModPython . ... Why Use mod_python . ... The sample configurations below are for a wiki instance called mywiki installed in a directory /var/www/moin/mywiki with the main MoinMoin installation installed in python's default site library path. ... Add a Location directive: <Location /mywiki> SetHandler python-program # Add the path of your wiki directory PythonPath "['/var/www/moin/mywiki'] + sys.path" PythonHandler MoinMoin.request.request_modpython::Request.run </Location> . ...
О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...
... General Information . ... For physics faculty . ... For natural faculties . ... Institute of General Physics RAN (Moscow) . ... Kazan State University (Kazan) . ... the science laboratories and group of the department have broad contacts with science and educational institutions around the globe: . ... Institute of Solid State Physics, Tokyo University . ... Institute of Solid State Physics, Vienna University of Technology . ... Institute of General Physics, Dresden Technical University, Germany . ...