... In the first period, the earth had two near-collisions with Venus, the first being in the time of the Hebrew exodus from Egypt and the second being on the day during Joshua's campaigns when the sun and moon stood still; see the discussion of the ?record? of the eclipse of 1130 September 30 in Section 11.2. ... During the second period, the earth had two or more near-collisions with Mars, and Velikovsky [p. 218 and p. 241] gives exact dates for the first and last of them. ...
... Current results . Scientific results . ... Microorganism and fungi . ... The microorganisms catalyze important changes in the biosphere, represent the source of the main atmosphere components and responsible for a significant part of the genetic diversity on our planet. ... That?s why the planned work will be an important factor in solving the fundamental problems in biology of microorganisms, while the results will become the basis for the development of new effective biotechnologies. ...
Slippage on hierarchical superhydrophobic surfaces (theory, simulation) The exceptional wetting properties of superhydrophobic (SH) surfaces [1] have motivated numerous applications in microfluidics. ... Recent experiments have shown that a hierarchical surface with nanoposts lying on the top of microposts does not necessarily lead to an increase in the effective slip length [5]. ... The main goal is to determine, how the effective slip length depends on the number of hierarchy levels. ...
A paper presented at the Round Table discussion on the problem "Regularities in Natural Language Dynamics" at Qualico-97, Chair of the round table discussion: Sheila Embleton] . Anatoliy A. Polikarpov . 1.There are some attempts to model Natural Language Lexical System change in time in quantitative aspect. ... This, naturally, presupposes arising of all basic lexical system regularities, i.e., regularities in macro-dynamics of the whole vocabulary of a language. ... POLIKARPOV A.A. [1976]. ...
... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...
[
Текст
]
Ссылки http://ccoe.msu.ru/sites/default/files/RU_Apps_Catalog_Sep13_LR.pdf -- 131.1 Кб -- 10.12.2013 Похожие документы
. - ИСТОРИЯ ГАИШ - хроника, музей, персоналии, мемуары . ГАИШ В ЛИЦАХ . ПЕРСОНАЛИИ Астрономической обсерватории Московского университета и ГАИШ . АКСЕНОВ Евгений Петрович (11.10.1933, пос. Побединка, Рязанской обл. - 26.03.1995, Москва). Астроном, известный небесный механик. Отец, Петр Андреевич, токарь, мать, Анна Кузьминична - домохозяйка. В 1952 А. окончил школу в пос. Побединка и поступил на астрон. отделение мехмата МГУ. В 1957 окончил его и поступил в аспирантуру по небесной механике (рук. проф. Н.Д.
... Web Extension to American Psychological Association Style (WEAPAS) (Rev. 1.4.3) [WWW document]. URL http://www.beadsland.com/weapas/ . Этот документ содержит дополнения к Приложению 3-A (Appendix 3-A, APA, 1994 , pp. 189-222) и использует стандарт Интернет касающийся унифицированных локаторов ресурсов (URL) ( Graham, 1995 ), используемый на World Wide Web (WWW или Web) ( W3C, 1995 ). ... Желающие использовать библиографический стиль MLA могут обратиться к Walker ( 1995 ) и Wainwright ( 1995 ). ...
Важнейшие публикации М.А. Гончарова . за последние годы ХХ века (по 2000 год включительно) . ... Белоусов В.В., Вихерт А.В., Гончаров М.А., и др. ... Гончаров М.А. Инверсия плотности в земной коре и складкообра зование. М.: Недра, 1979. 246 с. Гончаров М.А. Механизм геосинклинального складкообразования. ... Goncharov M.A. Balanced arrangement of tectonic flow and structural parageneses // Geotectonics (American Geophysical Union, USA.) ... Vol. ... Goncharov M.A . ...
... Kaplanb, Hovagim Bakardjiana, 4 Andrzej Cichockia 5 Laboratory for Advanced Brain Signal Processing, RIKEN Brain Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198, Japan b Department of Human and Animal Physiology, Faculty of Biology, Moscow State University, Russia a PROOF Combining the extremities on the basis of separation: 2 a new approach to EEG/ERP source localization 3 6 7 8 UNCORRECTED Abstract. ... The localization algorithm can be then applied to each of the separated sources. ...
[
Текст
]
Ссылки http://brain.bio.msu.ru/papers/Shishkin_Kaplan_Bakardjian_Cichocki_2005_IEPS8_CombiningExtremities_SourceLoc_proofs.pdf -- 75.0 Кб -- 19.11.2004 Похожие документы
МГУ имени М.В.Ломоносова Русская версия . ... Section ?Psychology? ... 29 Feb 2016 . ... 15 Apr 2016 . ... Chair Yury P. Zinchenko, professor, Dean of the Faculty of Psychology MSU . ... Chair Yury P. Zinchenko, Dean of the Faculty of Psychology MSU, academician RAE . ... A.G.Asmolov chair of the department of Personal Psychology, academician RAE; . ... B.S.Bratus chair of the department of General Psychology, corresponding member RAE; . ... Actual problems of sport psychology and healthy lifestyle. ...
... по всему сайту по геол. сайтам в каталоге в форумах в словаре в конференциях . ... Геология >> Инженерная геология | Анонсы конференций . ... 22.09.2008 | ... ДЕСЯТЫЕ СЕРГЕЕВСКИЕ ЧТЕНИЯ "Международный год планеты Земля: задачи геоэкологии, инженерной геологии и гидрогеологии" Москва, 20-21 марта 2008 г. 20.03.2008 | ... C 8 по 14 октября 2007 года на базе Института нефтегазовой геологии и геофизики им. А.А. Трофимука СО РАН будет проходить молодежная конференция Трофимуковские чтения 2007. ...
... There are three political actors developing and implementing the educational policy: the state, the market and academia. Depending on the role of each of these actors the educational policy models are defined. ... Given the modern tendencies of globalization, the study of educational policy models changes in the light of new institutional environment of Bologna process. ... Educational policy, educational policy models, educational policy actors, public and private partnership, Bologna process. ...
... J.-B. Lully: Armide - Prologue . ... La Gloire . Слава . La Sagesse . Мудрость . ... Tout doit ceder dans l'Univers . A l'Auguste Heros que j'aime. L'effort des Ennemis, les glaces des Hyvers, . ... La Gloire la Sagesse . ... Слава и Мудрость . ... Les Choeurs repetent ces cinq derniers vers: et la Suite de la Gloire celle de la Sagesse t moignent par des danses de joye qu'elles ont de voir ces deux Divinitez dans une intelligence parfaite. ... La Gloire, la Sagesse, les Choeurs . ...
... PHYSICAL INSTRUMENTS FOR ECOLOGY, MEDICINE, AND BIOLOGY LaserElectron X-Ray Source for Medical Applications E. G. Bessonov, A. V. Vinogradov, and A. G. Tourianskii Lebedev Physical Institute, Russian Academy of Sciences, Leninskii pr. ... It includes two electron storage rings (E 50 MeV) placed in the vertical plane and two laser resonators located in the horizontal and vertical planes. ... Electrons can be injected into the storage rings singly or during several cycles through the injectors. ...
ERC Starting Grant 2010 Physical Sciences and Engineering HI Country DE FR ES CH FR ES CH IL FR ES FR DE FR IL FR DE FR NL FR UK DE IL FR CH PT NO FR XShape ... Hyrax Middens and Climate Change in Southern Africa during the last 50,000 years Games and Automata for Logic Extensions Panel PE6 PE6 PE9 PE2 PE3 PE5 PE1 PE5 PE1 PE8 PE5 PE7 PE3 PE6 PE6 PE1 PE6 PE6 PE9 PE5 PE3 PE7 ...
... 4, 1998 Blue Light Inhibits Mitosis in Tissue Culture Cells L. A. Gorgidze,1 S. A. Oshemkova,1 and I. A. Vorobjev1'2 Received June 17, 1998 Irradiation of the mitotic (prophase and prometaphase) tissue culture PK (pig kidney embryo) cells using mercury arc lamp and band-pass filters postponed or inhibited anaphase onset. ... PK Cells Response to the Blue-light Irradiation The first question to be answered was whether irradiation of a whole cell with visible light inhibits mitotic progression. ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/gorgidze98.pdf -- 1449.4 Кб -- 13.05.2002 Похожие документы
... Experimental and theoretical study of structure and evolution of hadrons under extreme conditions at high energies . ... Physics of the solar wind, interplanetary magnetic field and solar-terrestrial relations . ... Neutron diffraction researches of nuclear and magnetic structure of new materials and its correlations with physical properties . ... Research of fractal structure of aluminosilicates gels by a method of small angle scattering of neutrons and synchrotrons radiations . ...
Международный учебно-научный лазерный центр МГУ им. М.В. Ломоносова . ... Новости . О МЛЦ МГУ . ... Заявки до 25 октября 2015г. Семинар МЛЦ и кафедры . ... Главная Новости Объявления . ... Семинар кафедры и МЛЦ 26 ноября 2008г ., среда, 15:00, ауд. им. С.А.Ахманова КНО . СЕМИНАР кафедры общей физики и волновых процессов и Международного учебно-научного лазерного центра МГУ . ... 2016 Заседание кафедры ОФиВП и МЛЦ . 12 февраля 2016 пятница, 15:00, ауд. им. С.А.Ахманова, КНО . ...
... Факультет Вычислительной Математики и Кибернетики . ... Работает в МГУ с 1995 г.: младший научный сотрудник (1995-1997), ассистент кафедры исследования операций (с 1992). Область научных интересов: математическое программирование, многопериодные задачи стохастической оптимизации, задачи с вероятностными ограничениями, финансовый анализ. ... Метод потенциальных функций для линейной двухэтапной задачи стохастического программирования // Дискретный анализ и исследование операций, сер. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы