... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... REVIEWS Measurement and Physical Content of Quantum Information B. A. Grishanin and V. N. Zadkov Received January 15, 2002 Abstract--Basic quantum information measures involved in the information analysis of quantum systems are considered. ... But today, it has become possible to intentionally vary directly quantum states of elementary quantum systems. ... 9 2002 MEASUREMENT AND PHYSICAL CONTENT OF QUANTUM INFORMATION 935 its information-equivalent copy is at the input and output. ...

Еще в разделе: (Показать все результаты (>65) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/jetp-96(4)-2003-preprint-en.pdf
• http://qilab.phys.msu.ru/papers/JETP-2003-96(4)-en.pdf
• http://qilab.phys.msu.ru/papers/PRA22309.pdf

... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...

Еще в разделе: (Показать все результаты (>3) - www.bio.msu.ru/ )

• Master In Nanobiotechnology ? Биологический факультет МГУ

A good description of how to make transformations between the different coordinate systems can be found in a paper by M. A. Hapgood, "Space physics coordinate transformations: A user guide", in Planetary and Space Science, Vol. ... X = First point of Aries (Vernal Equinox, i.e. from Earth to the Sun in the first day of Spring) . Z = Earth's mean spin axis . ... T = (Omega x R) / | ... X = Earth-Sun Line . Z = Ecliptic North Pole . ... Z = North Pole of solar rotation axis . ...

Еще в разделе: (Показать все результаты (>243) - www.kosmofizika.ru/ )

• Index of /lazutin
• Index of /ucheba
• Index of /history

ISSN 1060 992X, Optical Memory and Neural Networks (Information Optics), 2013, Vol. ... The used architectures of ANN allow detecting fluorescence of carbon dots against the background of proper fluorescence of egg protein with reasonably high accu racy­not worse than 0.002 mg/mL. ... This methodology includes elaboration of procedure of data preparation, determination of optimal neural network architectures, algorithms and parameters of their training. ... This is unfavorable for ANN training. ...

Еще в разделе: (Показать все результаты (>20) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/en/articles/2014/Using.pdf
• http://rswater.phys.msu.ru/Assets/Water/OMNN_2010.pdf
• http://rswater.phys.msu.ru/en/articles/2014/Application.pdf

... On the Geological and Physical Mechanisms of Natural Processes in Dynamic Geology Problems N. V. Koronovskii, A. A. Naimark, V. S. Zakharov, and G. V. Bryantseva Department of Geology, Moscow State University, Moscow, Russia e mail: koronovsky@rambler.ru, fnaim@ya.ru, vszakharov@yandex.ru, bryan@geol.msu.ru Received March 30, 2015 Abstract--The applicability of the abstract physical mechanisms in studies of concrete geological processes is considered. ... MOSCOW UNIVERSITY GEOLOGY BULLETIN Vol. ...

Еще в разделе: (Показать все результаты (>21) - dynamo.geol.msu.ru/ )

• http://dynamo.geol.msu.ru/personal/vsz/papers/Lubnina_etal_2015_eng.pdf
• http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_etal_2015_eng.pdf

A. M. PERELOMOV SOME COMMENTS TO THE PAPER A. V. BORISOV I. S. MAMAEV Department of Theoretical Mechanics MoscowStateUniversity,Vorob'ievy gory 119899 Moscow, Russia E-mail: borisov@uni.udm.ru Laboratory of Dynamical Chaos and Nonlinearity Udmurt State University Universitetskaya 1, 426034 Izhevsk, Russia E-mail: mamaev@uni.udm.ru between the geodesic ow on two-dimensional ellipsoid and a Hamiltonian system on algebra e(3) in the Clebsch case was rst indicated in 3]. ...

Еще в разделе: (Показать все результаты (>105) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/0cd/RCD232.pdf
• http://ics.org.ru/upload/iblock/8b0/187-the-dynamics-of-vortex-rings-leapfrogging-choreographies-and-the-stability-problem_ru.pdf
• http://ics.org.ru/upload/iblock/3e6/174-the-dynamics-of-nonholonomic-systems-consisting-of-a-spherical-shell-with-a-moving-rigid-body-inside_ru.pdf

... Data . ... Services . ... Solar energetic particles . ... N -d SW Conditions : Time profiles of the key geomagnetic ( Ap and Dst indices), solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM) parameters observed in the N day vicinity of the geomagnetic disturbed day. N -d Map of Solar Events : Map of solar surface events occurred within N day vicinity of the moment when the solar wind expansion (which causes the geomagnetic event) started. ... WIND . ...

Еще в разделе: (Показать все результаты (>17) - smdc.sinp.msu.ru/ )

• Home - Space monitoring data center
• COSRAD model - Space monitoring data center
• Coronas-F - Space monitoring data center

ИНФОРМАЦИЯ О БОЛЬШОМ СЕМИНАРЕ . ... РАН, профессор А.Н. Ширяев) . Программа на апрель 2008 г. 9 апреля - М.А. Урусов (Berlin University of Technology and Quantitative Products Laboratory, Deutsche Bank AG) . ... Координатор Большого кафедрального семинара на весенний семестр 2008 года профессор Дьячков Аркадий Георгиевич. Ученый секретарь Большого кафедрального семинара на весенний семестр 2008 года Воронина Анна Никитична (e-mail: vorronina@gmail.com). ...

Еще в разделе: (Показать все результаты (>25) - new.math.msu.su/ )

• http://new.math.msu.su/department/composite/konyukh.doc

Experimentation and Personality , 1 Explicating the Black Box through Experimentation : Studies of Individual Differences and Cognitive Processes Howard Lavine Department of Political Science, SUNY ­ Stony Brook Stony Brook, NY 11794-4392 Howard.Lavine@sunysb.edu Corresponding Author Milton Lodge Department of Political Science, SUNY ­ Stony Brook Stony Brook, NY 11794-4392 Milton.Lodge@sunysb.edu James Polichak School of Law, University of Michigan ... The Authoritarian Personality. ...

Еще в разделе: (Показать все результаты (>16) - suny.msu.ru/ )

• Center on Russia and the United States :: Summary of SUNY/MSU Center Activities

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>5) - mph.cmc.msu.ru/ )

European Research Council Guidance Notes for preparing the Grant Agreement ERC Grant Schemes (Starting Grant ­ Advanced Grant) 24 July 2008 The Guide is published by the ERC on http://erc.europa.eu It can also be downloaded from the CORDIS page on http://cordis.europa.eu ) This guidance1 is provided for information purposes and easing cooperation. These notes do not replace legal sources but aim at assisting participants who are invited for preparation of the Grant Agreement following the evaluation of

Еще в разделе: (Показать все результаты (>33) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/Work_programme_2011.pdf
• http://ideas.msu.ru/docs/CSA_guide_2008.pdf
• http://ideas.msu.ru/docs/guide_for_applicants_StG_2012.pdf

... Полная версия: Майский Слет ЭСТа МИФИ . Грация-МГУ::Форум > Общение > Общение . ... http://www.youtube.com/watch?feature=playe...p;v=9Q9X_DpmJvk . http://www.youtube.com/watch?feature=playe...p;v=0pB8GqXgJgY . http://www.youtube.com/watch?feature=playe...p;v=8jWXb7Vel7A . http://www.youtube.com/watch?feature=playe...p;v=ojaBKsroISk . http://www.youtube.com/watch?feature=playe...p;v=3kLVI2Qp7co . http://www.youtube.com/watch?feature=playe...p;v=7l1_w4EDWVY . ...

Еще в разделе: (Показать все результаты (>63) - grace.msu.ru/ )

• Майский Слет ЭСТа МИФИ - Грация-МГУ::Форум
• Грация-МГУ::Форум > самбочка...
• Грация-МГУ::Форум > Помогите опознать вальс

... UHECR SINP MSU . ... News . UHECR news . TLE news . Lab's news . ... Publications UHECR . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... Using the analytic modeling of the electromagnetic cascades compared with more precise numerical simulations we describe the physical properties of electromagnetic cascades developing in the universe on CMB and EBL background radiations. ... The new feature of the analysis is " E max rule". ... all news . ...

Еще в разделе: (Показать все результаты (>10) - uhecr.sinp.msu.ru/ )

• UHECR news
• Новости КЛПВЭ

The laboratory is engaged in fabricating high-efficiency catalysts and working out theoretical descriptions of kinetics and mechanisms of the processes which takes place in chemical power sources. ... The kinetics of electrooxidation of some simplest organic fuels is investigated, which is of interest for electrochemical generators. ... B.I.Podlovchenko, E.A.Kolyadko, Lu Shigan, Specific Features of Hydrogen Sorption by Pd Dispersed Forms at a-Phase Potentials // J.Electroanal. ...

Еще в разделе: (Показать все результаты (>17) - www.elch.chem.msu.ru/ )

• Laboratory of Electrical Double Layer and Electrode Kinetics

... The analytical results and numerical calculations reveal a principal disagreement with the generally recognized condition for the classical description, = Z1 e2 /hv 1(Z1 e and v are, respectively, Ї the charge and velocity of the projectile): for any value of , the quantum effects appear to be significant in the close vicinity of the projectile trajectory (small impact parameters) restricted by the distance = h/ mv . ... This effect results in an effective upper limit for r . ...

Еще в разделе: (Показать все результаты (>84) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LIIWM/JPhysB40_2007_F299Kab.pdf
• http://danp.sinp.msu.ru/LIIWM/PhysRevA64_2001_023201NMKab.pdf
• http://danp.sinp.msu.ru/LAS/Nimb256_07_21Teplova.pdf

... 161; --> ¡ --> cent sign ? ... 163; --> £ --> general currency sign ? ... yen sign ? ... 179; --> 3; ³ --> 3; acute accent ? ... 191; -- iquest; -- capital A, grave accent А #192; -- Agrave; -- capital A, acute accent Б #193; -- Aacute; -- capital A, circumflex accent В #194; -- Acirc; -- capital A, tilde Г #195; -- Atilde; -- capital A, dieresis or umlaut mark Д #196; -- Auml; -- capital A, ring Е #197; -- Aring; -- ...

Еще в разделе: (Показать все результаты (>13) - sbmg.geol.msu.ru/ )

• Calendar Converter
• Список элементов HTML

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>7) - srd.sinp.msu.ru/ )

... I. Bogdanova, R. F. Galeevb, S. P. Kulikb, and E. V. Morevac a Institute of Physics and Technology, Russian Academy of Sciences, Moscow, 117218 Russia b Faculty of Physics, Moscow State University, Moscow, 119992 Russia c Moscow Engineering Physics Institute (State University), Moscow, 115409 Russia Received October 12, 2006 Abstract--A model that approximately takes into account instrumental errors in problems of precision reconstruction of quantum states is considered. ...

Еще в разделе: (Показать все результаты (>69) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/kulik/Papers/pR4209_1.pdf
• http://qi.phys.msu.ru/papers/2013-njp-15-035012.pdf
• http://qi.phys.msu.ru/papers/2011-pra-84-042108.pdf

Real-time Raytracing (Software Rendering) Spherical Engine . Dynamic Objects and Lights; Per-Frame Per-Pixel Shadows Calculation . Support for Point, Directional and Spot Light Model Light Sources . Diffuse and Specular Lighting by Phong Illumination Model with Approximated Per-Pixel Light Attenuation . Diffuse Map Texturing with MIP-mapping and Trilinear Texture Filtering . ... SphericWorld 5.0 Demo (1.17MB WinRAR Archive) . ... Virtual Ray Ray Tracing Engine . RealStorm Engine . ...

Еще в разделе: (Показать все результаты (>18) - www.kge.msu.ru/ )

• PolyWorld
• Software Shaders
• Archive