News of PARALLEL.RU par-news на list.parallel.ru . Вт Окт 8 18:53:08 MSK 2013 . Следующее сообщение: PARALLEL.RU - Новости, выпуск #355 [22/10/2013] . ... РАН Вл.В.Воеводин ( voevodin на parallel.ru ) Почтовая рассылка о новостях сервера. Выпуск 354. 8 октября 2013 г. ------------- Уникальные суперкомпьютерные дни в МГУ! + 15 октября в 16:30 состоится специальное заседание семинара "Суперкомпьютерные технологии в науке, образовании и промышленности". ...
Кафедра общей топологии и геометрии . ... Публикации . ... Сипачева О.В. , The Topology of Free Topological Groups, Journal of Mathematical Sciences, vol. 131, no. 4, 2005, pp. ... Сипачева О.В. , Топология свободной топологической группы, Общая топология и топологическая алгебра. ... Резниченко Е.А. , Сипачева О.В. , The Fr\'echet--Urysohn and $\alpha_2$-properties in separable spaces, groups, and locally convex spaces, 13th Summer Conf. on General Topology and Its Applications, Mexico, 1998, pp.~ ...
... Symposium expenses . ... Abstract submission . ... 14 European Symposium on . Gas Phase Electron Diffraction . ... The deadline for abstract submission is 20 April, 2011. The abstracts have to be sent to the Symposium web address: ed.mos2010@gmail.com . ... Arial font and single spacing should be used throughout. The title should be centered and set with 14-point bold font style. ... The main body of text should be fully justified and set in 12-point regular font style. ...
... Unit I. Geologic Hazards and Man Unit II. ... Amazing Earth. ... Трансформируйте словосочетания в предложения. 1. geologic processes going on for millions of years 2. any geologic process can become a geologic hazard 3. some geologic hazards having resulted in disaster 4. many geologic hazards have affected the activity of man 5. a lot of earthquakes resulting in landslides 6. some naturally occurring hazards 7. many disasters are caused by geologic hazards 8. some ...
[
Текст
]
Ссылки http://www.geol.msu.ru/obsh/uch_ch2.doc -- 389.0 Кб -- 08.04.2016
[
Текст
]
Ссылки http://geol.msu.ru/obsh/uch_ch2.doc -- 389.0 Кб -- 08.04.2016 Похожие документы
Open Conference Systems . Conference Help . ... All Authors Title Abstract Index terms Full Text . ... Call for Papers (March 1, 2016 - June 1, 2016) . ... By Conference . ... It is incumbent on the authors to obtain appropriate approval to present their work to this international forum. 35-word Abstract : Your abstract should be a brief summary of your paper topic. If your paper is accepted, your 35-word abstract will be included in the Conference Program and the Technical Digest on CD-ROM . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... The delayed fluorescence of chlorophyll (DF) is an informative characteristic of the backward electron transfer in the reaction centers (RC) as well as of the functional activity of the photosynthetic apparatus (PSA) in vivo and in vitro under various physical and chemical factors (Hauvax, Lannoye, 1985; Rubin et al., ... Predominant bleaching of the long-wavelength fraction of chlorophyll provides evidence that oxidative reactions are located close to the reaction center of PSI. ...
... Методы, основанные на знании химического строения эндогенных и известных биологически активных соединений (середина 19 - конец 20 века). Современные методы, основанные на знании строения и функций биологических мишеней действия лекарственных соединений. ... Фармацевтическая, факмакокинетическая и фармакодинамическая стадии взаимодействия биологически активного соединения с организмом. ... Факультет фундаментальной медицины Московского государственного университета им. М.В. Ломоносова . ...
... XI--XVII . ... Ac A d e m I c r e A d I N g S Conference «Old Russian literature and television» M.V. Ivanova. old russian literature and contemporary russian television . ... e-mail: lanskoy@mail.ru. ... online. 28 2007, 13:00. http://www. expert.ru/interview/2007/03/28/pavlovsky/ 21 , , , . ... 2006, 39. http://www.expert. ru/printissues/expert/2006/39/prodazha_livejournal/print 22 , . ... 2007, 31. . ... 1917--1918 . ... Key words: Old Russian literature, plot, demonology, old printing Prologue. ...
[
Текст
]
Ссылки http://www.ftv.msu.ru/hst-notes/notes_2.pdf -- 1574.8 Кб -- 06.12.2010
[
Текст
]
Ссылки http://ftv.msu.ru/hst-notes/notes_2.pdf -- 1574.8 Кб -- 06.12.2010 Похожие документы
... info@ecfs.msu.ru . ... Home Resources Projects Draft Plan of Action for Eurasian Subregional.. ... On 7-9 September 2011, after long discussion between FAO and the European Commission, the launch of the Global Soil Partnership ( GSP ) took place at the FAO headquarters in Rome. ... The basic document indicates that Global Soil Partnership is based on regional soil partnerships. ... Assign the MSU Eurasian Center for Food Security as the Secretariat of the Eurasian sub-regional soil partnership. ...
Network Working Group T. Berners-Lee Request for Comments: 1945 MIT/LCS Category: Informational R. Fielding UC Irvine H. Frystyk MIT/LCS May 1996 Hypertext Transfer Protocol -- HTTP/1.0 Status of This Memo This memo provides information for the Internet community. This memo does not specify an Internet standard of any kind. Distribution of this memo is unlimited. IESG Note: The IESG has concerns about this protocol, and expects this document to be replaced relatively soon by a standards track document.
Alexander S. Antonov . ... M.V.Lomonossov Moscow State University . ... June 4, 1999, Moscow State University . ... 1994-2000: programmer, Laboratory of Parallel Information Technologies, Research Computer Center, Moscow State University . ... A.S. Antonov, A.M. Teplov. ... Antonov A.S., Voevodin Vl.V., Sobolev S.I., Filamophitskiy M.P. Internet-Auditorium of Lomonosov Moscow State University // Abstracts of the All-Russian scientific conference "Scientific Services Internet" (Novorossiysk, 2000). ...
? ? 1.???????????????? 3 2.Реформа и инновации в сфере государственных услуг в России. 8 3.Особенности развития экономики Шэньчжэня 26 4.в условиях модификации модели роста в КНР 26 5.???????????????? 39 6.СРАВНИТЕЛЬНЫЙ ОПЫТ УЧАСТИЯ РОССИИ И КИТАЯ В ИНСТИТУТАХ ГЛОБАЛЬНОГО УПРАВЛЕНИЯ 41 7.Принципы развития межрегиональных центров подготовки кадров для государственного управления в Российской Федерации 59 8.??????????????? 74 9.Региональные особенности государственного регулирования сферы образования в РФ 82
... Voronov, Vasiliy. Scalability and efficiency of parallel power grid simulations on massively-parallel platforms (submitted). ... 2009. ... Voronov, Vasiliy and Popova, Nina. ... Conference proceedings 2010. ... Abstract Book of SIAM Conference on Parallel Processing for Scientific Computing (SIAM PP10). ... Proceedings of the International Conference on Parallel Computing (ParCo-2009). ... IEEE Computer Press. ... Pozdneev, Alexander and Popova, Nina and Voronov, Vasiliy. ...
... Philosophical Transactions of the Royal Society (Biological Sciences) . ... Biochimica et Biophysica Acta (Elsevier Science) . ... Discrete and Continuous Dynamical Systems, Series B (American Institute of Mathematical Sciences) . ... Physics in Medicine and Biology (Institute of Physics) . ... Mathematical Medicine and Biology: A Journal of the IMA . Mathematical Medicine and Biology will publish original articles with a significant mathematical content addressing topics in medicine and biology. ...
... site navigation | footer (site information) . IChO-2007 Participation Problems IChO RUSSIA Sponsors search . ... Moscow-1996 | ... Chemistry Department | ... Homepages of National Competitions Other International Science Olympiads Previous IChO's Miscellaneous Chemistry sites . ... Some fresh information is available. A letter from the President of 39th IChO . ... Information about post-Olympiad tour is now available . ... Information about guides of 39th IChO is now available. ...
Economic, industry and corporate trends A report from the Economist Intelligence Unit sponsored by Cisco Systems Foresight 2020 Economic, industry and corporate trends Contents Preface Executive summary Chapter 1: The world economy Chapter 2: Industries Automotive Consumer goods and retailing Energy Financial services Healthcare and pharmaceuticals Manufacturing Public sector Telecoms Chapter 3: The company Appendix I: Survey results 2 3 6 22 24 30 36 43 50 57 62 67 74 86 Appendix II: Methodology for
[
Текст
]
Ссылки http://bc.fdo.msu.ru/Nik_s/WorkFiles/DOC_files/World_shares_foresight_2020.pdf -- 425.8 Кб -- 20.03.2012 Похожие документы
Lomonosov project . ... Mikhail Lomonosov . ... The studies of Lomonosov determined profile of Russian science forever, and we appreciate the discoveries of the leading Russian scientists as the studies of his direct learners and successors. A recognized and the most significant input of Lomonosov into natural science is molecular-kinetic theory of heat, developed during the prevalence of theory of specific fiery matter ? ... Lomonosov?s theory drawn wide response in European science. ... Aurora. ...
... кафедра Исследования операций . ... Приветствие Традиционные темы конференции Основные даты Оформление тезисов Регистрация Программа конференции Размещение Программный коммитет Организационный коммитет Координаторы Контактная информация . ... 10-14 апреля 2007 Программа конференции . ... академик РАН А.А. Петров . ... А.В. Кузнецова, В.И.Лукьянов, О.А.Максакова, И.С.Меньшиков, О.Р. Меньшикова, О.В. Сенько . ... секция . ... МГУ, ВМК, ауд. ... 11 апреля 2007 . ... среда, 11 апреля 2007, ауд. ...
... On-line консультант . ... В оформлении списка цитируемой литературы используются следующие поля: . ... Поле 6. Разделитель после поля пробел . ... Разделитель после поля : (двоеточие) пробел . ... Разделитель после поля , (запятая) пробел . ... Разделитель после поля пробел с (p латинское) (строчная буква) . ... Разделитель после поля пробел // (два слэша) пробел . ... Разделитель после поля [. (точка) пробел] ? ... Разделитель после поля пробел с. (строчная буква и точка) пробел Деп. в пробел . ...