... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>11) - www.issp.ac.ru/ )

• Contents of /univer/astro
• Contents of Russian pages of /univer

... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2396.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt

... REVIEWS Measurement and Physical Content of Quantum Information B. A. Grishanin and V. N. Zadkov Received January 15, 2002 Abstract--Basic quantum information measures involved in the information analysis of quantum systems are considered. ... But today, it has become possible to intentionally vary directly quantum states of elementary quantum systems. ... 9 2002 MEASUREMENT AND PHYSICAL CONTENT OF QUANTUM INFORMATION 935 its information-equivalent copy is at the input and output. ...

Еще в разделе: (Показать все результаты (>63) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/LasPhys10_03GrishaninLO.pdf
• http://qilab.phys.msu.ru/papers/PRA22309.pdf
• http://qilab.phys.msu.ru/papers/LasPhys-2001-11(12)-en.pdf

Lomonosov Moscow State University . ... Academic Programs . Academic Board . International Cooperation . ... Academic Departments Programs . ... Bulletin of Moscow University . ... Contact Us . Phone Email Directory . ... Phone: (495) 734 03 22 . Fax: (495) 932 88 67 . ... Phone: (495) 932 99 15 . ... Faculty of Foreign Languages and Area Studies Lomonosov Moscow State University: . ... 2000 - 2016 Faculty of Foreign Languages and Area Studies Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>101) - ffl.msu.ru/ )

... Brown x26; Mussett The Inaccessible Earth 01 Introduction.pdf . ... Brown x26; Mussett The Inaccessible Earth 02 Chapter.pdf . ...

Еще в разделе: (Показать все результаты (>50) - ocean.phys.msu.ru/ )

• Index of /courses/geo/lectures-addons/
• Index of /courses/geo/lectures-addons-11/
• Index of /courses/geo/lectures-addons/02/

... ЭОС истфака МГУ . ... x25BA; Кафедра исторической информатики . ... Course categories: Кафедра истории средних веков Кафедра исторической информатики Кафедра исторической информатики / Практика использования ДОТ Кафедра истории России до начала XIX века Кафедра новой и новейшей истории стран Европы и Америки Кафедры этнологии Археографическая лаборатория Школа учителей истории . ... Информационные технологии и математические методы в исторических исследованиях и образовании . ... Home ...

Еще в разделе: (Показать все результаты (>4336) - www.hist.msu.ru/ )

• ЭОС истфака МГУ: Course categories
• Электронная образовательная среда исторического факультета МГУ имени
• Summary of история россии 18 века

... The Russian Federation Presidential Commission on the modernization and technological development of Russian economy Project "Formation of Highly Qualified Supercomputing Technology and Dedicated Software specialist training system" is now complete. ... Lomonosov Moscow State University, . ... The nationwide system of Research and Education Centers for Supercomputing Technologies (REC SCT), incorporating all Russian Federal Districts, formed the basis for the successful implementation of the project...

Еще в разделе: (Показать все результаты (>30) - hpc.msu.ru/ )

• Nationwide Supercomputing Education Project | Moscow University Supercomputing
• MSU's HPC HISTORY | Moscow University Supercomputing Center

This section of library contains information about "classic" Star Catalogs. ... For a Henry Draper Catalog 272149 stars have received a total of 531,211 identifications in 7 сatalogs: . 270456 - in Astrographic Catalogue ( "Carte du Ciel", 4M), . 251943 - in Guide Stars Catalog (GSC), . ... A file with information on the components of 1788 of multiple systems in catalog HDEC (3681 component, or a combination thereof, with 4054 recording). ... A file with information about 21971 variable stars. ...

Еще в разделе: (Показать все результаты (>11) - astrometric.sai.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

A. M. PERELOMOV SOME COMMENTS TO THE PAPER A. V. BORISOV I. S. MAMAEV Department of Theoretical Mechanics MoscowStateUniversity,Vorob'ievy gory 119899 Moscow, Russia E-mail: borisov@uni.udm.ru Laboratory of Dynamical Chaos and Nonlinearity Udmurt State University Universitetskaya 1, 426034 Izhevsk, Russia E-mail: mamaev@uni.udm.ru between the geodesic ow on two-dimensional ellipsoid and a Hamiltonian system on algebra e(3) in the Clebsch case was rst indicated in 3]. ...

Еще в разделе: (Показать все результаты (>105) - ics.org.ru/ )

• Institute of Computer Sciences - Staff - Pivovarova Elena Nikolaevna

DEADLINE: Tuesday, February 1, 2005 I. Program Overview The ECA Alumni Small Grants Program (ASGP) is a professional and community development program open to alumni of the following ECA-sponsored exchange programs: the Contemporary Issues Fellowship Program (CI), the FREEDOM Support Act Undergraduate Program (FSAU), the Regional Scholars Exchange Program (RSEP) and the Russian-US Young Leadership Fellows for Public Service Program (YLF.) ... 2005 ECA Alumni Small Grants Program [pic] ...

Еще в разделе: (Показать все результаты (>69) - www.prof.msu.ru/ )

• Short questionnaire
• INTERNET RESOURCE LIST
• INTERNATIONAL FULBRIGHT SCIENCE AND TECHNOLOGY AWARDS

... Master Education . Second Education . ... Entrance requirements . ... personal statement addressed to the rector of MSU, containing the post-graduate course title and masters? program name . ... All applicants for full-time course (Russian students, both on scholarship and contract) are subject to following examinations: . ... All applicants to evening courses take an oral examination in the field of expertise. ... Второе высшее образование: second_edu@cs.msu.ru, 6-й этаж, комната 640, тел. ...

Еще в разделе: (Показать все результаты (>9) - hcs.cmc.msu.ru/ )

• Mathematical models and methods in VLSI design | Магистерское и послевузовское

... My research topic is application of the theory of dynamical systems to models of excitable media. ... One of the remarkable examples of an excitable medium is heart tissue. ... We have observed dynamics of phase singularities using some of the techniques for PS detection on the base of just one framework three-variable Fenton-Karma model with different parameters sets to reproduce various mechanisms of spiral wave breakup which in principle can occur in cardiac tissue. ...

Еще в разделе: (Показать все результаты (>156) - polly.phys.msu.ru/ )

• LCOptimizer Software
• Seminar in Polymer Physics
• P.N.S.P.M. Lab. - Research

... Роджер Пэнг (љ Roger Peng) на своем youtube-канале выложил видео 4х недель своего курса ?Computing for Data Analysis? Week 1 : . ... Data Types . ... Reading/Writing Data: Part 1 . ... The ?str? function . ... Writing Functions . ... The mapply function in R . ... Using the apply function in R . ... Plotting (base graphics) . ... Plotting with lattice . ... IBM SPSS Statistics 20 и AMOS: профессиональный статистический анализ данных Самые важные научные исследования последнего десятилетия. ...

Еще в разделе: (Показать все результаты (>5) - tukachev.flogiston.ru/ )

... file but would like it to be automatically updated # again, run the following command: # sudo dpkg-reconfigure -phigh xserver-xorg Section Files EndSection Section InputDevice Identifier Generic Keyboard Driver kbd Option CoreKeyboard Option XkbRules xorg Option XkbModel pc105 Option XkbLayout us ...

Еще в разделе: (Показать все результаты (>10) - observ.pereplet.ru/ )

• http://observ.pereplet.ru/images/evgeny/stev/m_download.php
• http://observ.pereplet.ru/images/z/backupsql.txt