... Наука >> Вычислительная математика >> Теория и алгоритмы | ... Научная дисциплина с неоднозначно переводимым на русский язык названием Theoretical Computer Science (теоретическая компьютерная наука? или все-таки информатика? я в любом случае буду для краткости использовать аббревиатуру TCS) существует в виде, более-менее напоминающем современный, около сорока лет. ... Этот переход во многом стимулировался пониманием того, что даже для наиболее базисных задач эти две вещи далеко не одно и то же. ...
... Семинары . ... UNИX . ... Immutable Page . Comments . ... Attachments . More Actions: Raw Text Print View Render as Docbook Delete Cache ------------------------ Check Spelling Like Pages Local Site Map ------------------------ Rename Page Copy Page Delete Page ------------------------ My Pages Subscribe User ------------------------ Remove Spam Revert to this revision Package Pages Sync Pages ------------------------ Load Save SlideShow . ... Участие в семинаре. ...
... Главная -> Фильмы -> Action . ... Фильмы . ... Фильмы в сети NetByNet . ... Драмы . ... Боевики . Ужасы . Комедии . Триллеры . ... Лучшие фильмы месяца . ... Все фильмы . ... Фильм Все >> . ... США 1967 . Комедия . Драма . ... Боевик . отметить . ... Mercedes McCambridge .. отметить . ... Великобритания - Аргентина - Испания - США - Швейцария 1974 . Триллер . ... William Holden .. отметить . ... США 2004 . ... Taylor Boggan .. отметить . ... США 2008 . ... США 2005 . ...
... The investigation of relativistic electrons precipitation and atmosphere reaction on electrons using data of near-polar satellites. Modeling of acceleration processes and dropout of energetic electrons in process of radial diffusion and interaction with electromagnetic waves in configuration-dynamic magnetosphere. ... Draft project: Jan - Dec 2007 . Documentation for Technological model: Jan - June 2008 . ... Construction documentation, Flight model: Jan - June 2009 . ...
... Is it the age of the soil or the age of the soil surface? ... Welcome Hari.. ... In stratigraphic context, age is the "calendar" age of the soil [surface] when buried. Conceptually, this is the "age" obtained when you radiocarbon date the buried soil [= buried paleosol]. Therefore in this context, age is the "date" of the soil. ... But, it is commonplace for geomorphic process ideas to be drawn into the interpretations to explain features that can not be explained by insitu processes. ...
... Process of Forming a Company - Discussion Question . ... You receive appropriate support from the University. Also University of Alberta statistics show that very few (less than 5%) technologies are successfully commercialized independently, whereas 50% of the technologies accepted by the University of Alberta are successfully commercialized. ...
... Российский фонд фундаментальных исследований, в рамках Соглашения с Нидерландской организацией по научным исследованиям (NWO), объявляет конкурс 2005 года совместных исследовательских проектов групп голландских и российских ученых по следующим областям знаний: . ... Согласованные заявки на участие в конкурсе представляются голландскими со-руководителями проекта через систему удаленной регистрации NWO, российскими со-руководителями проекта в 2-х печатных экземплярах в РФФИ, до 31 августа 2005 года . ...
hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . ... Регистрация . ... Серия Blue Gene в мире . ... Доступ по SSH . ... Регламент доступа . ... С 2008 года на факультете ВМК МГУ имени М. В. Ломоносова работает суперкомпьютер IBM Blue Gene/P, который является одной из первых систем данной серии среди установленных в мире. Архитектура Blue Gene была предложена компанией IBM в рамках проекта по исследованию возможностей достижения новых рубежей в супервычислениях. ...
Chlorophyll Fluorescence in vivo : A Theory (Part I) . Most part of the photosynthetic pigments in phytoplankton cell reside in peripheral pigment-protein complexes of the light-harvesting antenna (I, see Fig. ... From peripheral antenna complexes, excitation is efficiently transferred to core antenna complexes near photosynthetic reaction centers (II, Fig. 1), where it can be used in the primary photochemical reaction of photosynthesis. ... and phytoplankton concentration . ...
... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...
... Science Park . ... Agency for networking, information and communication technologies ( NETINFOKOM LLC) ank-nic@rambler.ru http://www.msunews.ru/ . ... Developing the infrastructure and information support needed for projects that provide an interdisciplinary exchange of science information and the potential for collective work on the base of network services and technologies. ... The company has a great deal of experience in the design, development and penetration of laboratory information systems. ...
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...
The current state of pine forest ecosystems exposed to long-term air pollution from the nickel-processing industry was investigated in the Kola Peninsula, north-western Russia. Air pollution has caused severe damage to vegetation due to direct injuries by sulfur dioxide and indirect impact, via soil and roots caused by input and release of heavy metals in acid environment or nutrient deficiency. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... pio . ... Рейтинг: 185 . computer ID . 04.05.2006 00:49 . ... Рейтинг: 4271 . Re: computer ID [ re: pio ] . ... Re: computer ID [ re: Weasel ] . ... Рейтинг: 38 . ...
... E. Anderson, Z. Bai, C. Bischof, J. Demmel, J. Dongarra, J. Du Croz, A. Greenbaum, S. Hammarling, A. Mckenney, S. Ostrouchov, and D. Sorensen, LAPACK Users' Guide, Society for Industrial and Applied Mathematics, Philadelphia, PA, second ed., 1995. ... E. Anderson, Z. Bai, C. Bischof, J. Demmel, J. Dongarra, J. Du Croz, A. Greenbaum, S. Hammarling, A. Mckenney, and D. Sorensen, LAPACK: A portable linear algebra library for high - performance computers, Computer Science Dept. ...
... Вниманию аспирантов! ... Вниманию аспирантов (группа проф. Хмелевской С.А.)! Семинар по истории и философии науки 30 марта отменяется. ... Вниманию аспирантов первого года обучения! ... Лекции по истории и философии науки будут читать проф. Яковлев В.А. по пятницам в 12:30, ауд. 5-18 (первое занятие 18 марта) и проф. Волкогонова О.Д. по понедельникам в 15:20, СФА (первое занятие 14 марта). ... Семинары по истории и философии науки будут проходить по вторникам в 17:00, ауд. ... Вниманию аспрантов! ...
... Вакансии . ... Commitment: the dedication to achieve your goals - and to continuous professional and personal development . ... HP Graduate Development Program: Our new 18 month Graduate Development Program has been designed to get the most out of the best graduates by giving you the opportunity to gain experience and exposure across HP's businesses. ... HP gives you the opportunity to transition from a brand new graduate to a professional in Sales, Information Technology, Consulting and Marketing. ...
... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 27 марта 2016 года Московский государственный университет имени М.В.Ломоносова приглашает на весенний ДЕНЬ ОТКРЫТЫХ ДВЕРЕЙ . ... New technologies in gas chemistry . ...