Geometrical core (core) is a maximal set of alignment positions such that C atoms in these positions are disposed similarly in ALL input protein chains. ... Minimal core size (#aa's) . ... Alternative core new atoms (%) . ... Geometrical core is a maximal set of alignment positions such that C atoms in these positions are disposed similarly in ALL input protein chain. ... Each input sequences is aligned to the corresponding sequence obtained from the ATOM section of the protein chain in the PDB file. ...
MORPHOLOGICAL CATALOGUE OF THE CRATERS OF THE MOON . ... Coordinates, diameters and morphological features of 14 923 craters of the Moon in diameters 10 km and more are available in the catalogue. ... A lunar morphological crater catalogue was compiled by the Sternberg State Astronomical Institute in collaboration with the Unified institute of Nuclear Research, Dubna. ... 4. the presence of central peaks, ridges and mountains on the floor . ... peak and many mountains . ... many peaks, 1 mountain . ...
SVETKA, a program for analysis of different alignments . Back to the help page . ... Such a feature can look like " Leucine in the position 362 of the alignment of the entire family " and can, in many cases, be a "decision rule" to distinguish sequences from two sides of a tree branch. ... Comparing the alignment with an input tree (the tree may be entered by the user or reconstructed with the WPGMA algorithm), the program detects supporting positions of the alignment for every branch the tree. ...
Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...
... We have compiled the Catalogue of extragalactic supernovae using the GCVS card catalogue. ... Doubtful (?), or rejected (-) SN 8 A1 --- RemFlag [*] The '*' indicates a remark in sn_rem.dat 10- 19 A10 --- Gal Parent galaxy designation 21- 22 I2 h RAh Right Ascension 1950 of Parent galaxy 23- 24 I2 min RAm Right Ascension 1950 (minutes) 25- 28 F4.1 s RAs Right Ascension 1950 (seconds) 29 A1 --- DE- Declination 1950 (sign) 30- 31 I2 deg DEd Declination 1950 of Parent ...
Summary of SUNY/MSU Center Activities . ... May 11, 2000: First meeting of the Board of Directors, SUNY Center on Russia and the United States. ... After some discussion, it was decided that SUNY and MSU would collaborate on the offering of three new SLN courses for spring 2001: Doing Business in Russia (SUNY Oneonta and MSU Faculty of Foreign Languages); Russian studies (SUNY Cortland and MSU Faculty of Foreign Languages), American studies (SUNY Buffalo and MSU Faculty of History). ... suny-msu . ...
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...
[
Текст
]
Ссылки http://smu.cs.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cs.msu.su/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cmc.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013 Похожие документы
... О UNИX . ... Неизменяемая страница . ... Другие действия: Показать разметку Вид для печати Сформатировать как Docbook Очистить кэш страницы ------------------------ Проверить правописание Похожие страницы Карта окрестностей ------------------------ Переименовать страницу Удалить страницу ------------------------ Подписать пользователя ------------------------ Очистить от спама Вернуть эту версию Страницы пакета Синхронизировать ... Руководство по установке ALT Linux Small Business . ...
16 June 2013 IAU Electronic Telegram No.3563 Central Bureau for Astronomical Telegrams INTERNATIONAL ASTRONOMICAL UNION CBAT Director: Daniel W. E. Green; Hoffman Lab 209; Harvard University ; 20 Oxford St.; Cambridge, MA 02138; U.S.A. e-mail: cbatiau@eps.harvard.edu (alternate cbat@iau.org) URL http://www.cbat.eps.harvard.edu/index.html Prepared using the Tamkin Foundation Computer Network SUPERNOVA 2013dj V. Lipunov, Sternberg ...
... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. ... April 11, 2013 - Bashneft Group in conjunction with JSFC "Sistema" opened the programme for the development of key Bashneft Group management - School of CEOs, "Capsule of security". ... At the end of his Welcoming Speech President of Bashneft Group stressed that this programme ? ... The School of CEOs ? ... 2006-2016 MSU Higher School of Management and Innovation. ...
... distant.msu.ru . ... Видеоархив МГУ . Список курсов . ... Курсы факультетов МГУ . Факультет мировой политики . ... Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1272 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1516 Курсы для школьников / Курсы от школ-партнеров / ГБОУ СОШ ?1159 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Школа ?2065 Курсы для школьников / Курсы от ... Открытые курсы МГУ . ...
... Moscow State University Belozersky Institute of Physico-Chemical Biology . The Department of Electron Microscopy offers positions in the area of molecular biology of the cell for excellent and highly motivated biologists at under-graduate or post-graduate level. Students : We are constantly offering diploma thesis and PhD thesis projects for students in cell biology and biophysics. The applicant is expected to have a strong interest in either experimental activity or computer modeling. ...
GDE alignment format is one of standard alignment formats. A popular program for sequence alignment, Clustal, for example, can save alignment in this format. In this format, all letters indicating amino acids are in lower case, gaps are indicated by dashes. Sequences are placed one after another, name of each sequence is placed onto a separate line and begins with ‘%’. The sequence is placed afterwards beginning on the next line and may be broken into several lines. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Роджер Пэнг (љ Roger Peng) на своем youtube-канале выложил видео 4х недель своего курса ?Computing for Data Analysis? Week 1 : . ... Data Types . ... Reading/Writing Data: Part 1 . ... The ?str? function . ... Writing Functions . ... The mapply function in R . ... Using the apply function in R . ... Plotting (base graphics) . ... Plotting with lattice . ... IBM SPSS Statistics 20 и AMOS: профессиональный статистический анализ данных Самые важные научные исследования последнего десятилетия. ...
... Новости . ... О кафедре . ... Занятия в среду 7.11.2012 по Современным компьютерным технологиям (преподаватель Краев А.В.) на первой паре не состоится и переносится в связи с календарным отпуском преподавателя. ... Автор: Краев Андрей Владимирович 06.11.2012 . ... Будут заслушены доклады Аристова А.И., Карамышевой Т.В., Краева А.В., Будановой А.В. Автор: Фурсов Андрей Серафимович 27.10.2012 . ... Colin Angle - основателя и руководителя компании iRobot, крупного специалиста в области робототехники. ...
Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . ... ICES Journal of Marine Science: Journal du Conseil . ... Immunological Reviews . ... Industrial & Engineering Chemistry Research . ... International Journal of Impotence Research . ... International Journal of Management Reviews . ... International Journal of Public Opinion Research . ... International Journal of Urban and Regional Research . ... Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . ...
системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи, базы данных, информационные технологии, технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование , математическое моделирование , вычислительный эксперимент, информатика, методы вычислений, численный анализ, ...
... Программы обучения . ... MВА . ... О ВШГА МГУ . ... ВШГА МГУ - это обучение на основе лучшего опыта зарубежных школ публичной администрации и традиций российского образования. ... Высшая школа государственного администрирования - факультет МГУ имени М.В. Ломоносова , член Международной ассоциации школ и институтов администрирования (IASIA) и Европейской группы государственного администрирования (EGPA). подробнее . ... Высшая школа государственного администрирования МГУ имени М.В.Ломоносова, . ...