Title Author Key words Suicides in the United Kingdom (1981­2011): dynamics, trends, especially S.V. Bogdanov, J.S. Bogdanova suicide, UK, men, women, age groups The dynamics completed suicides in the UK over the years 1981­2011. Discusses the distribution of suicides by sex, age. The geographical distribution of suicide mortality of the UK population by region. Abstract

Еще в разделе: (Показать все результаты (>35) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2011/2/06.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/2/07.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/2/08.pdf

... Centrosome and microtubules system, cell motility and polarization. ... Alieva I B, Vorobjev I A. Vertebrate primary cilia: a sensory part of centrosomal complex in tissue cells, but a "sleeping beauty" in cultured cells? Cell Biol Int. 2004;28(2):139-50. Vorobjev I A, Alieva I B, Grigoriev I S, Borisy G G. Microtubule dynamics in living cells: direct analysis in the internal cytoplasm. Cell Biol Int. 2003;27(3):293-4. Chernobel'skaia OA, Grigor'ev IS, Alieva IB, Vorob'ev IA. ...

Еще в разделе: (Показать все результаты (>39) - cellmotility.genebee.msu.ru/ )

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>5) - sinp.msu.ru/ )

... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...

Еще в разделе: (Показать все результаты (>7) - bioinf.fbb.msu.ru/ )

• SDPlight

... Astronomy search engine . ... PhysicsWeb Home Page . ... Sternberg Astronomical Institute . ... Astro Space Center Home Page . ... Landau Institute for Theoretical Physics . ... Astronomy and Space Physics Dept of Kiev University . ... NATIONAL RADIO ASTRONOMY OBSERVATORY Home Page . University of Hawaii - Institute for Astronomy . ... Space Telescope Science Institute Home Page . ... Sky & Telescope: The Essential Magazine of Astronomy . ... Springer LINK - Physics Online Library . ... Home . ...

Еще в разделе: (Показать все результаты (>176) - astro.uni-altai.ru/ )

Irena Lasiecka ( University of Virginia ) . Nikolai Melnikov (CEMI / MSU) . Mikhail Zelikin (MSU / Steklov Institute) . G. Avalos ( University of Nebraska , USA ) . V. Borisov (MSU, Moscow) . ... O. Emanouvilov ( Colorado State University , USA ) . A. Fursikov (MSU, Moscow) S. Hansen ( Iowa State University , USA ) R. Hildebrand ( Joseph Fourier University , France) V. Komornik ( University of Strassburg, France ) A. Kowalewski ( Institute of Automatics, Poland ) . ... Moscow) . ...

Еще в разделе: (Показать все результаты (>3) - oc.cs.msu.su/ )

About particularities of intensities distribution in cross-section of powerful laser beams . ... The time of the beam aperture scanning was about 10 -2 - 10 -3 s. On occasion to measure the intensity distribution in the beam cross-section the small spherical mirrors with the diameter of about 5 - 10 mm were placed instead of mirror fringes. ... Such technique allowed by character of a luminescence corundum to investigate transformations of spatial distribution of intensity in a laser beam. ...

Еще в разделе: (Показать все результаты (>9) - optics.sinp.msu.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... MIT (Massachusetts Institute of Technology) free library materials . ... Re: MIT (Massachusetts Institute of Technology) free library material [ re: Jilimili ] . ...

Еще в разделе: (Показать все результаты (>1498) - www.snto-msu.net/ )

• скопировать изображение без склейки слоев (фотошоп) - Public forum of MSU
• [OLE Excel]Скопировать строку - Public forum of MSU united student networks
• скопировать DVD, так чтобы смотреть можно было потом - Public forum of MSU

The opinion of the members of the Russian Rectors ' Union delegation of the results of the Fourth All- Russian Students ' Forum The Vice-president of the Russian Rectors ' Union, Chairman of the Council of Rectors of higher educational institutions of the Siberian Federal District and the Novosibirsk region, Rector of Novosibirsk State Technical University N.V. PUSTOVOY: The participation of the Russian ...

Еще в разделе: (Показать все результаты (>55) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/!2013/09/01/1.pdf
• http://www.rsr-online.ru/doc/2012_09_18/3.pdf
• About The Russian Union of Rectors

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Research topics . ... This group is formed to study the reactions at semiconductor surfaces. ... Group members: . ... M.V. Lomonosov Moscow State University: . ... Dr. Tatiana S. Zyubina, senior scientific researcher (quantum chemical modeling) . ... Joint Semiconductors Surface Study group: research sketches . The Joint Semiconductors Surface Study (JSSS) group was developed on the base of Inorganic Chemistry division, Chemistry dept. of M.V. Lomonosov Moscow State University. ...

Еще в разделе: (Показать все результаты (>40) - www.inorg.chem.msu.ru/ )

Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ­ Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology «New approaches to studying of classical problems». ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...

Еще в разделе: (Показать все результаты (>7) - www.fbm.msu.ru/ )

... A This result can be applied to a wide variety of data sets, including electricity bills1, street addresses, lengths of rivers, physical and mathematical constants, and processes described by power laws. ... Based on the plausible4 assumption that people who make up figures tend to distribute5 their digits fairly uniformly, a simple comparison of first-digit frequency distribution from the data with the expected distribution according to Benford's law had to show up any anomalous results. ...

Еще в разделе: (Показать все результаты (>7) - www.eng.math.msu.su/ )

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Gas Sensors Laboratory (SENSOR) , Department of Chemistry and Physics for Engineering and for Materials , University of Brescia , Italy: Prof. Giorgio Sberveglieri, Guido Faglia, Maurizio Artoni, Camilla Baratto, Dario Zappa. Lab contact Prof. Alexander Gaskov. ... Laboratory contact person: Dr. S.G. Dorofeev . ... 2008-2010 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>20) - www.lssm.inorg.chem.msu.ru/ )

• Лаборатория химии и физики полупроводниковых и сенсорных материалов
• Лаборатория химии и физики полупроводниковых и сенсорных материалов | Дирин

... Студенты МГУ им. Ломоносова едут в Лондон на финал CFA Institute Research Challenge . Результаты российского этапа международного студенческого конкурса CFA Institute Research Challenge подвела Ассоциация CFA (Россия). ... Студенты Московского государственного университета имени М.В. Ломоносова едут в Лондон на финал CFA Institute Research Challenge. ... Как уточняет пресс-служба CFA в России, Institute Research Challenge - международный студенческий конкурс по финансовому анализу. ...

Еще в разделе: (Показать все результаты (>66) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ

... Reply | Edit | ... Copyright (c) 1995, 2008, Oracle and/or its affiliates. ... The HelloWorldApp class implements an application that * simply prints "Hello World!" to standard output. */ class HelloWorldApp { public static void main(String[] args) { System.out.println("Hello World!" ... I notice it's been on trending for hours. Is it a chemical formula or anything else? ... Приглашаются программисты на РНР, 1С и VBA . ... edit: в комментах еще более питонистые варианты!) ...

Еще в разделе: (Показать все результаты (>2546) - www.fds-net.ru/ )

• скопировать изображение без склейки слоев (фотошоп) - Public forum of MSU
• [OLE Excel]Скопировать строку - Public forum of MSU united student networks
• Не могу скопировать больше 4 гигов - Public forum of MSU united student...

... Kaplanb, Hovagim Bakardjiana, 4 Andrzej Cichockia 5 Laboratory for Advanced Brain Signal Processing, RIKEN Brain Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198, Japan b Department of Human and Animal Physiology, Faculty of Biology, Moscow State University, Russia a PROOF Combining the extremities on the basis of separation: 2 a new approach to EEG/ERP source localization 3 6 7 8 UNCORRECTED Abstract. ... The localization algorithm can be then applied to each of the separated sources. ...

Еще в разделе: (Показать все результаты (>54) - brain.bio.msu.ru/ )

• http://brain.bio.msu.ru/cpbr8/8thConference_BP2004_Program.doc
• http://brain.bio.msu.ru/kapl_photo/7.htm
• BCI ALBUM | INTERESTING PEOPLE

... Boris A. Grishanin is an Associate Professor in the Department of Physics, M.V.Lomonosov Moscow State University (MSU). He received his M.S. and Ph.D. degrees from MSU in 1963 and 1968, respectively (both in Physics). ... B. A.Grishanin's current research interests are in the field of quantum theory of open systems, laser physics, molecular dynamics of photoexcited molecules, problems of quantum information and quantum computing. ... Information theory . ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>68) - qilab.phys.msu.ru/ )

... Grants and contracts . ... Graphics Media lab is a leader in international cooperation among laboratories of Department of computational mathematics and cybernetics, Lomonosov Moscow State University. ... Grant RFBR 14-01-00849 "People detection, tracking and annotation in video streams". ... Contract ?Advanced video processing for various video applications?, ... Contract ?Energy efficient video transmission over wireless channel and advanced video processing for various video applications?, ...

Еще в разделе: (Показать все результаты (>1091) - graphics.cs.msu.ru/ )

• Mikhail Sindeyev defended his PhD thesis | Graphics and Media Lab
• Defense of Ph.D. thesis of Konstantine Strelnikov | Graphics and Media Lab
• Defense of Ph.D. thesis of Victor Gaganov | Graphics and Media Lab

... On-line консультант . ... Анонсы Спецкурс компании SAS Institute Inc. Аналитическое программное обеспечение SAS (SAS Analytics software)' . Курс читается сотрудникам Учебного центра и департамента Аналитики компании SAS Institute, Moscow, а также преподавателями ВМК МГУ . ... Инструменты и методы анализа временных рядов и эконометрических данных большого объема и сложной структуры: SAS Forecast server, библиотека SAS Econometrics and Time Series Analysis. ... Copyright ВМиК МГУ , 2008 . ...

Еще в разделе: (Показать все результаты (>9) - erp.cmc.msu.ru/ )