... The analysis shows, that asteroid ­ rubble pile loses its fast fragments in no time but the retaining fragments forms a compact structure immersed in dust ­ gas atmosphere, created by interaction of interplanetary medium with dispersed product of collisional evolution of asteroid. By interaction of an asteroid ­ rubble pile with interplanetary medium structures asteroid can increase its brightness on account of blowed up dust simulating phenomenon of distant comet's brightening. ...

Еще в разделе: (Показать все результаты (>107) - selena.sai.msu.ru/ )

• Санович А.Н.
• Anatoly N. Sanovich
• Problem 2000

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>28) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Introduction QCD Sum rules Numerical analysis яonclusions ѕLEPTONIC CONSTANTS OF TENSOR MESONS IN QCD ї P. CHESNOKOV Physics Faculty of LOMONOSOV MOSCOW STATE UNIVERSITY General Nuclear Physics Department june 27, 2015 Lomonosov Moscow State University QFTHEP 2015 Contents 1 Introduction QCD Sum rules Numerical analysis яonclusions ... Lomonosov Moscow State University QFTHEP 2015 Introduction QCD Sum rules Numerical analysis яonclusions .. ...

Еще в разделе: (Показать все результаты (>198) - qfthep.sinp.msu.ru/ )

• September 09, 2010
• Bulletins'2010
• BULLETIN No.1

.

Еще в разделе: (Показать все результаты (>213) - nuclphys.sinp.msu.ru/ )

... Dr. G. Koptsik . ... Aim of this project is to develop a tool to quantify the risks of excess inputs of heavy metals to agricultural and forest ecosystems. ... Geographically the accent will be put on agricultural and forest ecosystems of the Northern (Kola Peninsula) and Central (Upper Oka-river basin) parts of Russia. ... Koptsik G.N., Nalbandyan K.F. 2002. ... Koptsik, S., Koptsik, G., and Eruslankina, L. Heavy metals in subarctic forest ecosystems: soil pollution and impacts on plant diversity. ...

Еще в разделе: (Показать все результаты (>24) - eco.soil.msu.ru/ )

• Koptsik G.N., et al. Soils of the National Park "Russian North".
• TRANSFORMATION AND STABILITY OF SOILS IN FOREST ECOSYSTEMS UNDER IMPACT OF

I. S. MAMAEV Institute of computer science 426034, Russia, Izhevsk Universitetskaya St., 1 E-mail: mamaev@rcd.ru NEW CASES WHEN THE INVARIANT MEASURE AND FIRST INTEGRALS EXIST IN THE PROBLEM OF A BODY ROLLING ON A SURFACE Received September 16, 2003 DOI: 10.1070/RD2003v008n03ABEH000249 Some new cases when the invariant measure and an additional first integral exist in the problem of a rigid body rolling on a sphere and on an ellipsoid are discussed in the paper. ... Rolling of a ball on a surface. ...

Еще в разделе: (Показать все результаты (>151) - ics.org.ru/ )

• Institute of Computer Sciences - Publications

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... We plan to create a multi-channel analyzer through a detector which comprises a semiconductor in addition to the selective line of resistive type sensors , the sampling system also allowing to carry out a catalytic conversion and concentration of target gases. ... 2008-2014 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>51) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and
• Лаборатория химии и физики полупроводниковых и сенсорных материалов | Проекты
• Лаборатория химии и физики полупроводниковых и сенсорных материалов | Дирин

ELENA ROVENSKAYA RUSSIAN . ... Optimization and optimal control, dynamic systems, mathematical modeling in economics and ecology . ... Elena Rovenskaya's research aims at the theoretical elaboration of new methods for solving optimal control problems (both analytical and numerical), as well as at application of existing methods to solve economic, social and ecological problems. ... 2009) Rovenskaya E.A. To the Solution of an Optimal Control Problem with State Constraints by Doubled-variations Method. ...

Еще в разделе: (Показать все результаты (>16) - oc.cs.msu.ru/ )

• CURRICULUM VITAE

... Living systems depository "Noah's Ark" . ... Home . ... Main grant . Current results . Scientific results . Publications . ... Animals . ... You can find the complete list of publications on the page of the grant in "Istina" system. Selected publications: . ... Moscow, 119991, . ... 7 (495) 939-10-00 . ...

Еще в разделе: (Показать все результаты (>7) - depository.msu.ru/ )

... The ICONO/LAT 2013 technical program will include plenary and keynote talks, invited and selected contributed papers encompassing all fields of quantum electronics, laser physics, and their applications. ... Best student paper awards sponsored by the Optical Society of America (OSA) and the ICONO/LAT 2013--four awards by 500USD in cash each (two oral and two poster presentations)--will be awarded at the conference for both best oral and poster presentations delivered by students. ... Overview . ...

Еще в разделе: (Показать все результаты (>7) - iconolat13.phys.msu.ru/ )

• Invited speakers

... GCVS Research Group: . Recent publications . Pastukhova, E.N., Antipin, S.V., Samus N.N., New GCVS data for selected variables in Telescopium, . IBVS No.5522, 2004 . ... Kazarovets E.V., Kireeva N.N., Samus N.N., Durlevich O.V., The 77th Name-list of Variable Stars, . ... Sokolovsky K.V., Samus N.N., Identification and light elements of BW Lib, . ... 5335, 2002 . Pastukhova E.N., Samus N.N., V928 and V929 Ophiuchi, . ... Antipin S.V., Samus N.N., V982 Oph is a Dwarf Nova, . ...

Еще в разделе: (Показать все результаты (>93) - sai.msu.ru/ )

• GENERAL CATALOGUE OF VARIABLE STARS

... November, 2005 . ... Moscow State University Russian Language Centre . ... Learn Russian at the Moscow State University! On November, 18th at Session of Advice of academic councils of the Moscow State University by ballot by the rector on the following five years have been selected Victor Antonovich Sadovnichy. (more.. ... Cinema lovers from across France and beyond are converging on the sea resort of Honfleur in Normandy to get a glimpse of contemporary Russian cinema (more.. ...

Еще в разделе: (Показать все результаты (>2) - www.rlcentre.com/ )

• "ABOUT RUSSIAN" - журнал о русских людях и их языке

Here is the new version of catalog originally created and developed by S. Melgunov. Site is discontinually updating by professional biologists and students of biology faculty of MSU. ... Your status is user . ... The purposes of JCatalog: . ... Here is the science journal catalog named JCatalog . ... JCatalog provide fast access to on-line content of journal on different mirrors, such as blackwell-synergy , sciencedirect Х e-library . ... All journals . 1747 all , 138 free, 756 full-text ] . ...

Еще в разделе: (Показать все результаты (>24) - journals.genebee.msu.ru/ )

• JCatalog - Different journal alphabetic indexes
• JCatalog - publishers alphabet index

Martes martes . Specific functional forms of behavior in pine marten Martes martes , based on snow tracking data . ... The paper describes the main functional forms of pine martenв?T Martes martes behavior which include leaving refuge, foraging, change of feeding area, patrolling their territory, locomotion to resting site, rest, and running for safety. ... The hierarchy of reactions in mammals is illustrated for the pine marten. ... Human impact changes the structure of behavior in pine martens. ...

Еще в разделе: (Показать все результаты (>1416) - zmmu.msu.ru/ )

• A preliminary survey on nest cavity use by Siberian flying squirrels, Pteromys
• Actual problems of modern theriology
• Craniometrical characteristics of some Sorex araneus chromosomal races

... Полная версия этой страницы: DjVu problem . Студенческий форум Физфака МГУ > Наука физика > Есть проблема . ... При попытке открыть некоторые ценные книги в формате DjVu выходит сообщение : . ... 9.12.2005, 1:29 . Как читать книги в формате DjVu с Pocket PC? Оочень хочется . ... имхо не хочется а нужно к экзамену.. могу сказать, что списывать с экрана кпк djvu книги в этой проге немного неудобно. то есть просто читать нормально, а что-то быстро-быстро найти не получится. подтормаживает.. ...

Еще в разделе: (Показать все результаты (>475) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > помогите скачать статью из IEEE
• DjVu problem - Студенческий форум Физфака МГУ
• Студенческий форум Физфака МГУ > MSc/PhD positions in the Optical Sensors for

... Главная -> Фильмы -> A Problem with Fear . ... Фильмы . ... A Problem with Fear . Канада 2003 . ... Marnie Alton . ... Gregory D. Alvas . ... Anita Matthys . ... Brian Stollery . ... Leigh Ann Taylor . Brian Wrench . ...

Еще в разделе: (Показать все результаты (>75) - kinfo.ru/ )

• Problem Child - Фильмы - Kinfo.ru
• The Dog Problem - Фильмы - Kinfo.ru
• Modern Problems - Фильмы - Kinfo.ru

2013-2014 1. ISO 12207:1995. , , (). : , , , , . ... set, ordered set, bag, sequence). ... UML, . ... RUP, , , . ... OCL. , , , , (collect, select, forAll, exists, isEmpty, notEmpty, size, sum, min, max, count, includes, excludes, intersection, union, closure, flatten, sortedBy). (append, prepend, insertAt, indexOf, at, first, last, reverse). let, iterate. N- (tuple), product. allInstances, oclIsTypeOf, oclIsKindOf. oclAsType, asSet, asBag, ... . ... Rational Unified Process (RUP). ...

Еще в разделе: (Показать все результаты (>131) - sp.cs.msu.ru/ )

• Performance of DVM-programs
• DVM-system. Installation guide. Version 3.60
• DVM-system. Installation guide. Version 3.82

. Yu.A.Shokin . Accurate positions of variable stars in the western part of the Large Magellanic Cloud bar . (published in IBVS and SAI Proceedings ) . B.S.Vozdvijenski, N.P.Gorbatko, V.A.Yeliseev, G.V.Romanova . The results of the observations of the selected minor planets in Sternberg State Astronomical institute . (published in SAI Proceedings ) .

Еще в разделе: (Показать все результаты (>13) - astrometric.sai.msu.ru/ )

• Specification

... For impatient users: You can download RusTeX in three different ways (Full installation; Selective download; Diskette-ready minimal installation) --- so at least read explanations about these methods before you download something. Please, use "Save link as" (right mouse button) for downloading files, otherwise .arj files and other binary files will be corrupted. ... TeX files are compact and readable in any text viewer: just text and commands for formatting and commands for equations drawing. ...

Еще в разделе: (Показать все результаты (>2) - tex.bog.msu.ru/ )

html head title Перемещение слоя в режиме drag /title script language= javaScript !-- var app; var szx= 0 ; var szy= 0 ; var new_layer = ; var drag_layer =0; function start_drag () { app = document.applets.red; if(app.get_mouse_state(2)==1) { // нажата клавища мыши if(app.get_selected_in_layer_num(' square_red ')==0) { // выбран красный квадрат app.start_ ...

Еще в разделе: (Показать все результаты (>7) - adept.srcc.msu.ru/ )

• http://adept.srcc.msu.ru/adept/java/applet_book/ch_box/ch2text1.htm
• АДЕПТ инструментальный программный комплекс