Peter Scheglov ­ pioneer of site testing in the Central Asia A.Tokovinin & V. Kornilov Promote astronomy iin the Promote astronomy n the Central Asia Central Asia Tashkent P..Scheglov iidentified CenttralAsiian siites wiith PScheglov dentified Cen ral Asan stes wth a llarge ffraction off cllear sky and callm attmoa arge raction o cear sky and cam a mospherre, iin colllaboration wiith metteorologists. sphe e, n colaboration wth me eorologists. ... Problems of optical astronomy). ...

Еще в разделе: (Показать все результаты (>3) - site2010.sai.msu.ru/ )

• Information

... David Kirk/NVIDIA and Wen-mei W. Hwu , 2007-2012 ECE408/CS483, University of Illinois , Urbana-Champaign 14 CUDA Device Memory Management API functions · cudaMalloc() ­ Allocates object in the device global memory ­ Two parameters · Address of a pointer to the allocated object · Size of of allocated object in terms of bytes ( Device ) Grid Block (0, 0) Block (0, 1) Registers Registers Registers Registers · cudaFree() ­ Frees object from ...

Еще в разделе: (Показать все результаты (>3) - ccoe.msu.ru/ )

... Study of the Russian " Silver Age " neology . ... Dictionaries of neologisms constitute an important part of lexicography. ... The peculiarity of our project is the full scope of text (at least published) considered and uniformity of description: dictionary entries of all the authors’ neologisms have the same format (suggested for Khlebnikov’s neology). ... Khlebnikov's neology (N. N. Pertsova). In 1995 "The Dictionary of Khlebnikov's Neologisms" was published. ...

Еще в разделе: (Показать все результаты (>7) - lcl.srcc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• ConClus
• StructAlign help

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>21) - www.msm.biophys.msu.ru/ )

• Accomodation

... Using Ar clusters accelerated by 30 kV, with a dose of ° ° 6 · 1014 e cmю2, we have effectively removed an asperity that was 3500 A wide and 350 A high. Subsequent processing ° ° with 5 kV acceleration reduced the surface roughness from an Ra value of 13.2 A to 4.8 A. This demonstrates the effectiveness of GCIB for reducing sub-micron roughness to atom level smoothness. с 2005 Elsevier B.V. All rights reserved. ... Technique and results Fig. 1 shows schematically the GCIB beamline [2]. ... Fig. ...

Еще в разделе: (Показать все результаты (>55) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LIIWM/JPhysB40_2007_F299Kab.pdf

sin, cos, log [1 , N] c 1 . ... for-, , , sizeof. /* beg, beg+step,...,beg+step*(N-1) */ #include <stdio.h> #include <math.h> /* . define N 5 /* , N =10 */ struct Func { char* name; /* double (*fp)( double ); /* } func [] = { { sin , sin { cos , cos { log , log { NULL, NULL }; */ */ }, }, }, } int main() { int beg = 1, /* - step = 1, /* end = beg + (N-1)* step , /* - numfuncs = sizeof( func )/sizeof(struct Func ) - 1; /* func int i; ... sin | ... cos | ...

Еще в разделе: (Показать все результаты (>2) - al.cmc.msu.ru/ )

... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...

Еще в разделе: (Показать все результаты (>3) - physelec.phys.msu.ru/ )

• http://physelec.phys.msu.ru/staff/zykovapubl.doc

... CONDENSED MATTER L ocalized-to-Propagating Surface Plasmon Transitions in Gold Nanoslit Gratings1 M. I. Dobynde, M. R. Shcherbakov, T. V. Dolgova, and A . ... For the narrower slits, the transmittance spectra show features associated with pure PSP excitation. ... Values to the left are the slit width values. ... The propagation length spectr um for the grating with a slit width of 300 nm shows a maximum at 620 nm, which also exceeds the propagation length value along the non-perforated gold f ilm. ...

Еще в разделе: (Показать все результаты (>50) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/acsphotonics.pdf
• Khokhlova Maria | Laboratory of Nanophotonics & Metamaterials

... Выпускники . Выпускники ВМиК . ... Женский клуб . ... Издательство МГУ . ... Новости для выпускников . МГУ им.Ломоносова . ... База данных выпускников . ... Выпускники МГУ . ... Дайв-Клуб МГУ . ... Бригада испанских врачей завершила первую в мире операцию по пересадке двух ног. ... Операция длилась 14 часов и завершилась во вторник утром. ... Dr. Pedro Cavadas of La Fe Hospital in Valencia, Spain, performed the world's first double-leg transplant. ...

Еще в разделе: (Показать все результаты (>66) - www.moscowuniversityclub.ru/ )

... 2009/2010 . ... 2009 , 1 / 11 1 const C++ 2 . ... 2009 , 2 / 11 -- ( ) &_ = ; , . ... 2009 , 3 / 11 -- #i n c l u d e < i o s t r e a m > u s i n g namespace s t d ; i n t main ( ) { int i = 42; i n t &r e f _ i = i ; ++ i ; c o u t << " i : " << i << e n d l ; c o u t << " r e f _ i : " << r e f _ i << e n d l ; ++r e f _ i ; c o u t << " i : " << i << e n d l ; c o u t << " r e f _ i : " << r e f _ i << e n d l ; system ( " pause " ) ; return 0; } . ... 2009 , 7 / 11 double Square(double x), . ...

Еще в разделе: (Показать все результаты (>10) - ani.cmc.msu.ru/ )

• http://ani.cmc.msu.ru/files/geo-2009-prac-05.pdf
• http://ani.cmc.msu.ru/files/geo-2009-prac-01.pdf
• http://ani.cmc.msu.ru/files/geo-2010-prac-01.pdf

Magnetism Department MSU . ... Students . Phd students . ... On this page themes of scientific work for 2nd year students actual for this year are presented. ... Magnetic effects . New magnetic materials . ... Observation metods of domain structures in magnetic materials . ... Features of magnetic properties of amorphous materials . ... Composite materials that change their shape, dimensions and mechanical properties in magnetic field . ... Dynamical properties of vortex magnetic structures . ...

Еще в разделе: (Показать все результаты (>6) - magn.phys.msu.ru/ )

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

136. List of research papers of Prof

137. http://www.sai.msu.ru/dept/adm/lamzin/2300951.pdf

138. http://al.cs.msu.su/static/seminars/catfl/materials/task2.pdf

139. http://lhe.sinp.msu.ru/~gladilin/gaum_gaumint.inc

140. http://www.mgumus.chem.msu.ru/publication/2008/2008-vladimirov-comparison.pdf