... For full UV energy Euv (erg) radiated in TLE the corresponding number of photons of wavelength =300-400 nm (with average energy 3.5 eV) is: Nph=Euv/3.5в1.6 10-12 (1) We considered 2 options of the pinhole camera focal distance: 1. focal distance is short so that the circle of diameter 40 km is observed by one pixel and 2. focal distance is long so that the 40 km circle is observed in many camera pixels. ... Full energy released in UV in the atmosphere is determined by the pixel signal. ...

Еще в разделе: (Показать все результаты (>2) - cosrad.sinp.msu.ru/ )

... Anti thrombin DNA aptamers were immobilized on silica microspheres, placed inside microwells on the distal tip on an imaging optical fiber, coupled to a modified epifluorescence microscope through its proximal tip. ... It should be mentioned that since thrombin is not a DNA binding protein, the possibility to elicit thrombin­aptamer complexes clearly demonstrates the power of SELEX technology. ... Specificity of aptamer coated beads for F thrombin binding was assessed with bovine serum albumin. ...

Еще в разделе: (Показать все результаты (>5) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/nar2004.pdf
• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf
• http://rnp-group.genebee.msu.su/pdfs/MolRus4_01RassokhinLO.pdf

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>171) - www.pereplet.ru/ )

• Герхард Шрайбер

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ...

Еще в разделе: (Показать все результаты (>3) - ani.cs.msu.su/ )

... Дата рождения : 18.05.1966 г. Место работы : Московский государственный университет им. М.В.Ломоносова, Кафедра биофизики Биологического факультета . ... Образование: 1988 г. - Биологический факультет МГУ, специальность "Биофизика", 1993 г. - канд.биол.наук, специальность "Биофизика", . Профессиональная деятельность: 1993 - 1995 - научный сотрудник Биологического ф-та МГУ; 1996 - по н/в - доцент Биологического ф-та МГУ . ...

Еще в разделе: (Показать все результаты (>7) - biophys.msu.ru/ )

• Группа математического Моделирования

Аксенов Сергей Михайлович . ... В 2006 году поступил на кафедру минералогии и геохимии Российского государственного геологоразведочного университета им. С. Орджоникидзе (РГГРУ-МГРИ). В 2011 году защитил диплом на тему 'Геологическое строение Хибинского щелочного массива, особенности химического состава и строения цеолитоподобных минералов группы эвдиалита, как индикаторов условий образования' и получил квалификацию горного инженера по специальности 'прикладная минералогия, геохимия и петрография'. ...

Еще в разделе: (Показать все результаты (>30) - cryst.geol.msu.ru/ )

... Physical Geography and Landscape Science . ... Science . ... Sergey A. SOKRATOV . ... Laboratory of Snow Avalanches and Debris Flows & Arctic Environment Laboratory, Faculty of Geography, M.V. Lomonosov Moscow State University . ... 1988 1990 Term Appointment Researcher at the Institute of Geography, Russian Academy of Sciences, Moscow, Russia . ... 1985 1989 Part-in-time Research Assistant at Laboratory of Snow Avalanches and Debris Flows, Faculty of Geography, Moscow State University, Russia . ...

Еще в разделе: (Показать все результаты (>14) - eng.geogr.msu.ru/ )

• Department of Land Hydrology
• Department of Cartography and Geoinformatics
• Department of Landscape Geochemistry and Soil Geography

... Head of the laboratory of amorphous and crystalline alloys of rare earth metals. ... Physics of magnetics, magnetic phase transitions, magnetic properties of rare earth compounds. ... Experimental study of the magnetic properties of rare earth alloys and compounds. ... Three-critical point on magnetic phase diagram was found in dysprosium and rare earth alloys. ... Giant magnetocaloric effect has been found in rare earth metals, Fe-Rh alloy and a series of intermetallic compounds. ...

Еще в разделе: (Показать все результаты (>5) - ferro.phys.msu.ru/ )

R Arg -3.8 K Lys -2.46 N Asn -2.27 Q Gln -2.12 E Glu -1.78 D Asp -1.57 H His -1.09 Y Tyr -0.98 S Ser -0.1 G Gly 0 T Thr 0.42 A Ala 0.67 C Cys 1.48 M Met 1.67 P Pro 1.75 V Val 2.18 W Trp 2.86 L Leu 3.02 I Ile 3.02 F Phe 3.02 Calculated values (H) for hydrophathy based on the transfer of solutes from water to alkalane solvents. ...

Еще в разделе: (Показать все результаты (>3831) - kodomo.fbb.msu.ru/ )

• Alex Makarov. Personal Page. My works. 4th semester.
• Alex Makarov. Personal Page. CREDIT1.
• Alex Makarov. Personal Page. My works. 3rd semester.

... ГЛАВНАЯ АРХИВ . О кафедре . ... Архив О кафедре 1988 1989 учебный год . Архивная информация о кафедре. ... физики" href="/stud_gen/22">Методы математической . физики . Специальные курсы . ... Факультативные курсы . Семинар кафедры . ... математической физики . ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>18) - matematika.phys.msu.ru/ )

• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова |

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

- . . 2006 "" . . grishan@comsim1.phys.msu.ru · + · · [. . , 85 2 (8), 447 (1983)] [. . , . . , . . , 47, 887 (1987), . . , . . , 6, 15 (1988)] · . . - " " : ! : : 0 t ? 0 2 ... ... t-2 t- t - : () fs ps ns ? ! " " , . . . , 85 2 (8), 447 (1983): : " " , , "" : - " " - 0 : ) ; ) ; ) ) - Rb Xe: 0.52 0.50 0.48 0.46 0.44 0.42 0.40 -80 -60 -40 -20 0 20 1 2 3 4 5 : PF Q 40 60 80 > 0 : ( )? -? · "" · "" . .

Еще в разделе: (Показать все результаты (>34) - qilab.phys.msu.ru/ )

Professor of Physics (1921-1999) . ... P.N. Lebedev Gold Medal for outstanding work in Physics (1987) Physics of semiconductors, especially radiation damage, ion implantation methods, luminescence of semiconductors. V.S. Vavilov, V.F. Kiselev and B.N. Mukashev. ... V.S. Vavilov. The peculiarities of the physics of wide band-gap semiconductors and their applications. Uspekhi Fizicheskikh Nauk 164 , 287 (1994). ... Uspekhi Fizicheskikh Nauk 164 , 429 (1994). ...

Еще в разделе: (Показать все результаты (>40) - scon155.phys.msu.su/ )

• X-ray diffraction investigations of phase transitions in narrow-gap IV-VI
• Off-center impurities
• Программа курса "Применение вычислительной техники к исследованию

« » , , 24 -28 2013. 1- 24 28 2013. . () « », 125 .., 1918. 1920 , . . . « » 1988., 1998. : . : , . .. ( , , ), , . .. (.) . : . .. (, .) : .. (.), .. (.), . .. (.), . .. (.-), . .. (.), . .. (.), . .. (.), . .. (.), . .. (.), . .. (.), . .. (.-), . .. (.), . .. (.), . .. (.), . .. (.), . .. (.), .. (.), .. (.), .. (.), .. (.), .. (.). « » ; 1. . 2. . 3. . , . « » cosmograv@yandex.ru . www.cosmograv.ru

Еще в разделе: (Показать все результаты (>20) - temporology.bio.msu.ru/ )

• Лаборатория-кафедра "Природа времени и пространства в истории науки и философии

... Афонин Александр Михайлович . Баранов Владимир Иванович . Бердюгин Владимир Васильевич, 16.09.1951-03.10.2011 . Данилов Владимир Александрович, 1954-1996 . ... Кондратков Александр Иванович, 1953 - 1988 . Костюкевич Владимир Сергеевич 26.04.1954 - 10.08.2015 . ... Молодцов Сергей Владимирович, 01.04.1954 - 17.12.2014 . Некучаев Александр Орович, 1954 - 2016 . Проскуряков Александр Сергеевич, 1954 - 2014 . ... Рязанов Александр Васильевич, 1954 - 11.04.2004 . ...

Еще в разделе: (Показать все результаты (>9) - upmsu.phys.msu.ru/ )

• Выпуск 1958 года.
• Выпускники

... Graduated in 1964 from the Faculty of Mechanics and Mathematics (Moscow State University). Ph.D. in Mathematics and Physics (1988). Professor of the Department of Applied Mechanics and Control (1993) at the Faculty of Mechanics and Mathematics of Moscow State University. Associate Member of the Academy of Technological Sciences (1992), Member of the International Academy of Astronautics (1995), Member of the International Academy of Sciences for Higher Education (1994). ...

Еще в разделе: (Показать все результаты (>13) - vestnik.math.msu.su/ )

• Вестник МГУ. Математика. Механика Редколлегия журнала "Вестник Московского

... Вестник МГУ Антропология . ... Н.Н. Гончарова окончила кафедру антропологии биологического факультета МГУ в 1988 годы. ... 1997-1999 Институт археологии РАН, научный сотрудник Подмосковной экспедиции . ... 2008-2010 Научно-исследовательский институт и Музей антропологии им.Д.Н.Анучина . Копирование материалов web-сайта только с разрешения администрации НИИ и Музея антропологии МГУ! ... При использовании материалов, размещенных на сайте НИИ и Музея антропологии МГУ, ссылка на источник обязательна! ...

Еще в разделе: (Показать все результаты (>14) - www.anthropos.msu.ru/ )

• Борис Николаевич КАЗАЧЕНКО || Научно-исследовательский институт и Музей

Стромберг А.Г., Семченко Д.П. Издательство: Высшая школа . ... Учебник написан на современном научно-методическом уровне. В нем отражены достижения физико-химической науки по всем ее трем методам: квантовой химии, химической термодинамики и химической кинетики и катализа. ... Третье издание учебника по физической химии (2-е в 1988 г.) соответствует новой программе по физической химии для химических специальностей вузов. ... Для студентов химических специальностей вузов. книга " Физическая химия. ...

Еще в разделе: (Показать все результаты (>292) - www.chemport.ru/ )

• Иллюстрированный химический словарь. А. Годмен
• Стереохимия. В.М. Потапов
• Мир химии. Марк Колтун

1. - - - - - http://www.elch.chem.msu.ru/rus/educ.htm 1 · -- , , ( ). 2 1..., .., «», « », ., 1987 . 2..., .., « », « », ., 1983 . ... 1952 . ... 5.., ., ., «», «», ., 1977 . ... 7.., « », «», ., 1967 . ... 3 - - - - 4 1.1 ­ 1.4 - - . 1887: - - - . ... 1919: , z1 z2 2 z1 z2 e0 F =- 4 0 r 2 F = r n+1 , n>1 dU F = - ; F (r0 ) = 0 dr 2 z1 z2 e0 G = N A A 4 0 r0 1 1 - n 6 2.3 - ., ...

Еще в разделе: (Показать все результаты (>2) - www.elch.chem.msu.ru/ )

RAID Levels "Redundant Arrays of Independent Disks, or RAID, has revolutionized the way on-line data is stored in computers. ... RAID Level 0 (Disk Striping) RAID Level 0 is a performance oriented striped data mapping technique. ... RAID Level 0 provides high I/O performance at low inherent cost. ... ST310299 RAID Level 3 RAID Level 3 adds redundant information in the form of parity to a parallel access striped array, permitting regeneration and rebuilding in the event of a disk failure. ...

Еще в разделе: (Показать все результаты (>91) - www.parallel.ru/ )

• Timers and synchronization | PARALLEL.RU - Информационно-аналитический центр по
• Bibliography | PARALLEL.RU - Информационно-аналитический центр по параллельным