... Next Routine] [List of Routines] NAME: ADD_HEADER PURPOSE: addition information from FITS-headers MPFS-frames DESCRIPTION: The function computes the total exposure, mean value zenit distance and modified FITS header CALLING SEQUENCE: Result =ADD_HEADER( headers ) CATEGORY: reduction MPFS-data INPUTS: Headers = String array FITS-headers from the MPFS data OUTPUTS: Header = String array containing the header from the FITS file. ... OPTIONAL INPUT KEYWORD PARAMETERS: BEFORE = Keyword string name. ...

Еще в разделе: (Показать все результаты (>48) - sn.sai.msu.ru/ )

... Submit a Paper . Before submitting your paper for the ICONO/LAT 2013 please read the guidelines for preparation of the conference papers. We manage all paper submissions for the ICONO/LAT 2013 with the help of the Lomonosov Scientific Portal developed at the Lomonosov Moscow State University specifically for the conferences needs. Pushing the button below you will leave the conference site and go to the Lomonosov portal for papers submission. ... Program overview . ... Registration info . ...

Еще в разделе: (Показать все результаты (>15) - iconolat13.phys.msu.ru/ )

• Program topics

... Студенческая Астрономическая обсерватория ГАИШ . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... For those really interested in galaxies, extragalactic astronomy or the aspects of cosmology we study, we can always find an interesting problem to work on. ... To make your work in the Group most effective, it would be useful to study the following courses read by our group members as well as the members of other groups in our and other institures. ... Student information . ...

Еще в разделе: (Показать все результаты (>17) - www.sai.msu.ru/ )

... Geography of World Economy . ... Physical Geography and Landscape Science . ... Structure . ... Field stations . ... Type of field courses . ... The Faculty of Geography is the largest scientific and educational centre of geography in the world. ... The Faculty consists of 15 specialized departments, 8 research laboratories and 4 field stations, where 800 employees work. The Faculty of Geography also has 8 research laboratories.There are 3 branches of the faculty: in Sevastopol, Astana and Geneva. ...

Еще в разделе: (Показать все результаты (>110) - eng.geogr.msu.ru/ )

• Interuniversity council for erosion and fluvial processes
• Newsletter «RUSSIAN SUSTAINABILITY NewsLETTER»
• Renewable Energy Sources

... Institutes of Chernogolovka . The largest of all the scientific institutions of the center is the Institute of Chemical Physics in Chernogolovka , where fundamental problems of chemical physics are studied: kinetics and mechanisms of chemical and biological processes; processes of combustion, explosion, and polymerization; and mechanisms of elementary reactions involving high energy particles. ... Developments and Technologies . ...

Еще в разделе: (Показать все результаты (>9) - www.issp.ac.ru/ )

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>239) - www.genebee.msu.ru/ )

• TreeTop - Phylogenetic Tree prediction
• Medicine - Selected Journals (J)
• Multiple alignment

Irina IVANOVA Transformation of the Southeast Asian social and economic space in the process of integration of the region into the global information economy Introduction. ... Common problems are superconcentration of economic activity in overpopulated centers, poor transport access to peripheries and lack of national and global connectivity. ... The nodes of the spatial framework of the Malacca Strait economic region have hierarchical structure as global, regional, national centers (pic.6). ...

Еще в разделе: (Показать все результаты (>426) - www.geogr.msu.ru/ )

• vuxoa
• Instructions for Authors, contributing to “GEOGRAPHY, ENVIRONMENT,
• journal 'GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY'

LabVIEW 2011 1 .. ... DAQ- 1. ... Functions -. Numeric, , Functions >> Programming (. 6). ( , e .) ... LabVIEW , , PCI, , USB. DAQ- ( Data AcQuisition = ). ... USB 6009 N = 14 , 2 14 = 16384 . ... USB 6009 DAQ ; ; ; USB . ... National instruments Data Acquisition (DAQ) USB terminal / . ... DAQ Assistant. DAQ Assistant ( Functions >> Express >> Input), -, . ... DAQ- USB 6009, , 1. ... data DAQ Assistant - , , ­ . ... DAQ Assistant Std Deviation&Variance , , data, , Std Deviation&Variance. ...

Еще в разделе: (Показать все результаты (>45) - genphys.phys.msu.su/ )

• http://genphys.phys.msu.su/rus/school/Khokhlov.pdf
• Микромаг - сервер

... Academic Programmes . ... Russian Language Programmes . ... A balanced program of speaking, listening, writing and reading skills ensure that all students make progress as quickly as possible. ... Listening/Speaking : you will be able to understand basic instructions or take part in a basic factual conversation on a predictable topic. ... Reading : you will be able to read quickly enough to cope with an academic course, to read the media for information or to understand non-standard correspondence. ...

Еще в разделе: (Показать все результаты (>31) - www.cie.ru/ )

• Structure :: About Center for International Education :: CIE
• Elective Courses :: Academic Programmes :: CIE

... http://www.univ-lorraine.fr/ . We have long-time collaboration with scientists from Laboratoire de Physique Moleculaire et des Collisions, Institut de Chimie, Physique et des Materiaux. 14 joint papers were published so far. ... http://www.uclouvain.be/ . ... There were published about 10 joint papers on mathematical aspects of few-body scattering theory in the case of Coulomb potentials. ... http://www.phys.msu.ru/ . ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>13) - lmmqsp.sinp.msu.ru/ )

... We are working on the restoration and digitaziation of the Moscow Naturalist Society library. This will allow to avoid readers? direct contact.љ This will allow to avoid readers? direct contact with the most valuable and fragile exemplars in order to preserve them as well as to make the library?s resources accessible worldwide. ... The history of the library starts from the book collection of Fischer von Waldheim, the Society?s first director. ... 2015 Moscow Society of Naturalists . ...

Еще в разделе: (Показать все результаты (>7) - www.moip.msu.ru/ )

The Department of Talented Youth Affairs and Professional Orientation . ... Older posts . Posted on 09.11.2015 by admin . ... The team competitions Continue reading . Posted in News , Без рубрики | Leave a comment . ... In the 2015/16 Continue reading . ... The festival is organized by the Department of Continue reading . ... Posted on 17.11.2014 by admin . ... Federal Agency for Youth Affairs ?Rosmolodezh?, ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>37) - talant.msu.ru/ )

• editor | The Department of Talented Youth Affairs and Professional Orientation
• News | The Department of Talented Youth Affairs and Professional Orientation
• admin | The Department of Talented Youth Affairs and Professional Orientation |

... What this in mind being done on the theory of systems or systemology acquires particular significance. ... This book is like that: systematic by subject and by presentation. In the first part the author deals with the nature of systems analysis in detail and in the second applies it to the more general semiotic problems of cybernetics. ... One of the individual aspects of the book is its attempt to present the essence of systemology from a single point of view. ...

Еще в разделе: (Показать все результаты (>84) - old.philol.msu.ru/ )

• HumLang: Polikarpov A.A.- Menzerath's Law for Morphemic Structures of Words:A
• MSU-LGCLL:: Curriculum Vitae of Anatoliy Anatolyevich Polikarpov
• HUMLANG - announcements

VI Fulbright Summer School in the Humanities . ... Reading Everyday Life in American and in Russian: Semiotics of Culture and Intercultural Communication . Fulbright Summer School in the Humanities is held annually since 1997 under the aegis of the Fulbright Program in Russia, Moscow University and the Russian Association for American Studies in partnership with a number of American universities (particularly, SUNY). ... The goals of the Summer School are . ... Director of the Summer School: . ...

Еще в разделе: (Показать все результаты (>172) - www.prof.msu.ru/ )

• A new name and address for State Exchange
• Humanitarian Component As A Part Of International Business Curriculum
• Training For Effective Intercultural Communication

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Reactivity thermoelectric clathrate compounds in interaction with components of the air . The project aims to address the fundamental problems of solid state chemistry - revealing the fundamental regularities of the reactivity of crystalline phases in reactions with air components and processes of formation of oxide layers (coatings) for new materials. ...

Еще в разделе: (Показать все результаты (>48) - www.lssm.inorg.chem.msu.ru/ )