Automata, Semigroups, and Universal Algebra Edited by Strutura| heory of Valery B. Kudryasev and Ivo G. Rosenberg NAo Siene Series NAo Sciene Series A Series presenting the results Programme. of sientific meetings supported under the NATO Siene The Series is pub|ished by IoS Press, Amsterdam, and Springer (former|y K|uwer Aademi Pub|ishers) in conjuntion With the NATo Pub|i Dip|omay Division. ...

Еще в разделе: (Показать все результаты (>120) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: :: Articles
• Options dialog
• Options

. This page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>72) - chaos.phys.msu.ru/ )

• Dzhanoev's home page
• Nonlinear Dynamics''s Page
• Postnikov's home page

. This page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>114) - hbar.phys.msu.ru/ )

• Какой сейчас век? Лекция 6
• Какой сейчас век? Лекция 5
• Catalogue of ancient and medieval eclipses

... The Institute is staffed wit h a team of 15 experts involving 6 Ph.D programs including ap plied mathematics, theor etical ph ysics, technolog y for computer applications, signal and information processing and bi ochemical, collab orating wit h experts in p hysiolog y, biolog y, iatrolog y, etc. and sp eci all y engaged in t he research of Human Brain Project and neuro- infor matics. ... Chinese Ph ysics , Jovrnal of Optics, Chinese Ph ysics Letter. ...

Еще в разделе: (Показать все результаты (>188) - www.psy.msu.ru/ )

• Psychology in Russia: State of the Art, Vol. 5, 2012

... Master . ... SAI MSU . Conference was supported by PLC "MO "OPTIKA" . ... Morning session . Chair Hugo Levato (ICATE, Argentina) . ... Vladimir Lipunov ( MSU , SAI ) . ... Evgeniy Gorbovskoy (MSU, SAI) & . А lexander Belinskiy (MSU, SAI) . ... Chair Claudio Mallamaci (OAFA, Argentina) . ... Using MASTER Net in the MSU educational process . ... Chair Victor Kornilov (MSU, SAI) . ... Nikolay Budnev (ISU ) . ... Excursion to the Moscow Kremlin . ... Joint MASTER and Russian Pereplet session. ...

Еще в разделе: (Показать все результаты (>51) - master.sai.msu.ru/ )

• International Workshop ?Robotic observatories?
• Circulars
• Contacts

. This page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>2) - getmedia.msu.ru/ )

. This page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>270) - num-anal.srcc.msu.ru/ )

• Артикли
• Запятые

Publications of E.N. Efremenko . ... Chemical Department . ... Chemical Enzymology Department, Chemical Faculty . The M.V. Lomonosov Moscow State University, Lenin's Hills, 1/11 Moscow 119992, Russia . ... Senior researcher, Chemical Enzymology Department, Chemical Faculty, The M.V. Lomonosov Moscow State University, 1999-present . ... Since 1999 Chemical Enzymology Department, Chemical Faculty, The M.V. Lomonosov Moscow State University, Head of Group "Microbial Biochemistry and Biotechnology. ...

Еще в разделе: (Показать все результаты (>139) - www.enzyme.chem.msu.ru/ )

• Group of microbial biochemistry and biotechnology
• Organometallic&Biomimetics
• Kluwer Academic Publishers - Doklady Biochemistry and Biophysics

... II « » Symposium "Big History and Global Evolution" « : , , , » ( ) "Big History and Global Evolution" Scientific School for Youth "Historical globalistics: historical evolution, the present and forecast scenarios of global networks, global processes and institutions of global scale, and role of Russia and BRICS" (supported by RSCF) : .. ... 21 » International Scientific Symposium on Sustainable Development "Global Development: local conflict and challenges during 21st century : .. ...

Еще в разделе: (Показать все результаты (>98) - fgp.msu.ru/ )

... Under physiological conditions, nucleoside diphosphate kinase (EC 2.7.4.6, NDPK) catalyzes the reactions of nucleoside triphosphates synthesis from ATP and the respective nucleoside diphosphates. ... During the last years, we have studied properties and functions of NDPK in the outer compartment of rat liver mitochondria. ... Why did we decide to study NDPK of the outer compartment of rat liver mitochondria? ... T.Y. Lipskaya (2001) Biochemistry (Mosc), 66, 115 - 129. ...

Еще в разделе: (Показать все результаты (>97) - biochem.bio.msu.ru/ )

• Molecular identification of the enzyme responsible for the mitochondrial
• Generation of superoxide by the mitochondrial Complex I.
• Partitioning of superoxide and hydrogen peroxide production by mitochondrial

... High Brightness RTM . ... Techniques to generate short, small emittance electron bunches of several nC at energies of several MeV are being developed to drive free electron lasers, for accelerator research, to provide short laser Thomson scattering X-ray pulses, and to generate intense coherent millimeter radiation (e.g., synchrotron, transition, etc.) ... Generating several tens of MeV beams now requires large, expensive, energy inefficient accelerators available only at large laboratories. ...

Еще в разделе: (Показать все результаты (>3) - vserv.sinp.msu.ru/ )

... Second-year students classes . Introduction to Linux . ... 32-bit Microcontroller Programming . ... In the given practical special course we address user techniques for working with Linux OS; we study the interface of the command line in great detail, methods of automation and batch processing, composition of scientific articles as well as the specifics of software design by using in-built toolkit. ... Use of console interface of the command line, automation (bash scripts) . ...

Еще в разделе: (Показать все результаты (>73) - engineering.phys.msu.ru/ )

• X Congress of Russian Rectors Union
• Parallel Programming

SVETKA, a program for Analysis of Multiple Sequence Alignments . ... Analyse your alignment . ... Alignment . Nota Bene! .aln or .fasta format required!! Look here for comments . ... Nota Bene! Special scheme format required! ... Development of the program is supported by Ministry of Education and Science of the Russian Federation (State Contract No. ...

Еще в разделе: (Показать все результаты (>13) - mouse.belozersky.msu.ru/ )

• Blocks finder
• Geometrical core
• PDB entries containing domains of the family "RNA dependent RNA polymerase"

Chair of General Physics and Wave Processes, Physics Faculty of MSU . ... Science and education . ... Scientific Laboratories . ... Science . ... Education . 20.09.2009 . 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . Moscow Vyatichi, November 9 - 11, 2009. ... Main Science and education Scientific Laboratories Laboratory of ultrafast processes in biology . ... All laboratory`s grants . ... 2009 ILC MSU Made in: Sebekon IT Solutions . ...

Еще в разделе: (Показать все результаты (>769) - ofvp.phys.msu.ru/ )

• Сайт кафедры общей физики и волновых процессов
• Laboratory of Nonlinear Spectroscopy of Ultrafast Processes in Condensed Matter

... РЕФЕРАТЫ СТАТЕЙ ПО РУКОКРЫЛЫМ / ABSTRACTS OF BAT ARTICLES . Молекулярная филогенетика семейства рукокрылых Vespertilionidae / Molecular phylogenetics of the chiropteran family Vespertilionoidae : Hoofer, S. R., Van Den Bussche, R. A. ? ... Murininae и Kerivoulinae ? ... Leuconoe , Selysius и Myotis ? ... Phylogenetic analysis of ribosomal gene sequences provides well-supported resolution for vespertilionid relationships across taxonomic levels. ...

Еще в разделе: (Показать все результаты (>1087) - zmmu.msu.ru/ )

• Species status for Miniopterus pallidus - abstract
• Variation of he baculum structure of the Palaearctic badger (Carnivora,
• Breeding bird atlas of European Russia

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... 001.89:004 .. , .. , .. , .. , .. , .., .. e-mail: kryukov@theory.sinp.msu.ru RESTFUL-- 2012-4/882 RESTful-- , : , , , UNIDATA Common Data Model, , , , , , . ... NCEP/NCAR [1], , ). , . ... RESTful-- , : , , , UNIDATA Common Data Model [2], , , , , , . ... UNIDATA Common Data Model (CDM) [2]. ... UNIDATA CDM 3. ... XML . ... Unidata Common Data Model. : http://www.unidata.ucar.edu/software/netcdf-java/CDM/ [3]. ... Network Common Data Form (NetCDF). : http://www.unidata.ucar.edu/software/netcdf/ [5]...

Еще в разделе: (Показать все результаты (>3) - sinp.msu.ru/ )

... Research . ... Home Research Grants and Contracts . ... Support of leadingљresearchљschools (grantљNo. ... Russian Foundation for Basic Research grants inљ2002-2013 . ... 12-03-00653:љљ PI -љ Natalia V.љAvramenko . ... jointly withљthe Institute of General and Inorganic Chemistry of RASљand Moscow Institute of radiotechnics, electronics and automatics) . Colloquium on 24.12.12 20 Dec 2012 . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>8) - td.chem.msu.ru/ )

Department of Physics, Lomonosov Moscow State University . Laboratory "Сryoelectronics" . Laboratory of Cryoelectronics (LCE) was established in the beginning of 1988 on the base of scientific group of Prof. Konstantin K. Likharev originated in 70-th at Physics Department of Moscow State University. ... As it was circumstantially formed, two organizations equipped our laboratory: the Physical Department of MSU and the section of Microelectronics of SIMP (NIIYaF) MSU. ...

Еще в разделе: (Показать все результаты (>8) - cryolab.phys.msu.ru/ )

• About laboratory

On-line Data . COHO data . ... PIONEER 10 . ... PIONEER VENUS ORBITER . OMNI data . OMNI Data Set . LASRE data . CORONAS-I (electrons) . CORONAS-I (protons) . ... COSMOS 1686 (electrons) . COSMOS 1686 (protons) . ... Satellite Informations Selector . ... AKEBONO AMPTE Cluster II / Phoenix DMSP Dynamics Explorer (DE) Equator-S FAST Freja GOES-7 GOES-8 Geotail Hawkeye IMAGE (GSFC) IMAGE (SwRI) IMP-8 ISEE Interball LANL MSX Oersted POLAR SAMPEX SOHO UARS Ulysses Voyager WIND . ...

Еще в разделе: (Показать все результаты (>12) - dbserv.sinp.msu.ru/ )

• ULYSSES Online Data Set Selector
• Catalogue of Space Storms
• SW and GM conditions